Bacterial Translocation Markers as Predictors of Infectious and Inflammatory Complications in Acute Bowel Obstruction

Study Results

Results available

Outcome measurements, participant flow, baseline characteristics, and adverse events have been published for this study.

View full results

Basic Information

Get a concise snapshot of the trial, including recruitment status, study phase, enrollment targets, and key timeline milestones.

Recruitment Status

COMPLETED

Total Enrollment

150 participants

Study Classification

OBSERVATIONAL

Study Start Date

2021-03-01

Study Completion Date

2023-12-31

Brief Summary

Review the sponsor-provided synopsis that highlights what the study is about and why it is being conducted.

Despite modern approaches to the diagnosis and treatment of acute bowel obstruction (ABO), postoperative mortality ranges from 5 to 32%, and complications occur up 23% of cases. One of the formidable infectious and inflammatory complications of ABO is sepsis. The main component of the development of sepsis in ABO is bacterial translocation (BT). BT is the migration of intestinal bacteria or their products through the intestinal mucosa into the mesenteric lymph nodes and further into normally sterile tissues and organs.

Today there are several methods for detecting BT:

1. direct method - the detection of 16s rRNA (ribosomal ribonucleic acid) in mesenteric lymph nodes (MLN);
2. indirect method - the detection of serum lipopolysaccharide-binding protein (LBP) and presepsin (Soluble CD14 subtype or sCD14-ST).

The aim of this study is to determine the diagnostic and prognostic significance of bacterial translocation as a predictor of the complications development in patients with malignant and benign acute bowel obstruction by assessing the relationship of biomarkers in the systemic circulation (LBP, sCD14-ST) with the detection of microorganism genes (16s rRNA) in mesenteric lymph nodes.

Related Clinical Trials

Explore similar clinical trials based on study characteristics and research focus.

Stoma Tube Decompression and Postoperative Ileus After Major Colorectal Surgery

NCT01911793

Ileus Bowel Obstruction

TERMINATED NA

Impact of Prior Identification and Education of Patients Requiring a Digestive Stoma for Fecal Diversion

NCT06881303

Colorectal Anastomosis Endometrial Anastomotic Leak Rectum +5 more

NOT_YET_RECRUITING NA

Prediction of Intra-abdominal Infectious Complication by Drainage Fluid Analysis

NCT03862378

Complication Anastomotic Leak Intraabdominal Infections +2 more

UNKNOWN

Comparison of Early Operative Treatment and 48 h Conservative Treatment in Small Bowel Obstruction

NCT03139149

Small Bowel Obstruction Small Bowel Adhesion Strangulation of Ileum

UNKNOWN NA

S1316, Surgery or Non-Surgical Management in Treating Patients With Intra-Abdominal Cancer and Bowel Obstruction

NCT02270450

Constipation, Impaction, and Bowel Obstruction Unspecified Adult Solid Tumor, Protocol Specific

COMPLETED NA

Detailed Description

Dive into the extended narrative that explains the scientific background, objectives, and procedures in greater depth.

For the early diagnosis of infectious and inflammatory complications, it is necessary to study LBP, sCD-14 and 16sRNA as bacterial translocation markers in patients with malignant and benign acute bowel obstruction, as well as in patients after planned surgical intervention for colon tumors. Based on changes in bacterial translocation biomarkers in the blood serum, it's suggested that patients with researched pathology can be stratified according to the risk level of developing infectious and inflammatory complications.

The study materials are blood serum and mesenteric lymph nodes (MLN). Venous blood sampling will be performed 1 hour before surgery, 24 and 72 hours after it. Venous blood will be collected in 5 ml vacutainers with a coagulation activator and a serum gel separator. It will be centrifuged for 20 minutes at 1000 x g, after which the gel completely separates the serum from the clot, forming a tight barrier.ELISA Kit for Lipopolysaccharide Binding Protein (LBP, Human) and for Presepsin (sCD14-ST, Human), from Cloud-Clone Corp. will be used to determine any presence of LBP and sCD14-ST. The analysis will be performed according to the manufacturer's instructions for an ELISA EVOLIS robotic system from BioRad.

The operating surgeon will perform a MLN sampling in sterile conditions during surgery after resection of the intestine from the mesentery of the gross specimen. MLN will be placed in a sterile tube without any fillers. The DNA will be extracted by the GeneJET Genomic DNA Purification Kit manufactured by Thermo Fisher Scientific, USA, in accordance with the manufacturer's instructions. The 16s rRNA bacteria in MLN will be detected by using real-time PCR and BIO-RAD CFX96 amplifier with 16s rRNA forward and reverse primers (U16SRT-F FACTCCTACGGGAGGGAGGCAGGT and U16SRT-R TATTACCGCGGCTGCTGGGC).

During the implementation, the resources of the Collective Use Laboratory of Research Center Non-profit Joint Stock Company (NJSC) "Karaganda Medical University" will be used.

This research is funded by the Science Committee of the Ministry of Education and Science of the Republic of Kazakhstan (Grant No. AP09260597).

Conditions

See the medical conditions and disease areas that this research is targeting or investigating.

Intestinal Obstruction Colorectal Cancer Post-Op Complication Systemic Inflammatory Response Syndrome Colon Tumor

Study Design

Understand how the trial is structured, including allocation methods, masking strategies, primary purpose, and other design elements.

Observational Model Type

OTHER

Study Time Perspective

PROSPECTIVE

Study Groups

Review each arm or cohort in the study, along with the interventions and objectives associated with them.