JAK2 Mutation May Predict Response and Guide First Line Treatment in Rheumatoid Arthritis

NCT ID: NCT04667988

Last Updated: 2020-12-16

Basic Information

• Recruitment Status: COMPLETED
• Clinical Phase: NA
• Total Enrollment: 76 participants
• Study Classification: INTERVENTIONAL
• Study Start Date: 2019-01-01
• Study Completion Date: 2020-05-01

Brief Summary

This study included 76 newly diagnosed RA patients and 50 matched controls. Basal JAK2 mutation was assessed by PCR in blood samples, TNF-α and IL 6 were measured by ELISA in serum of patients and controls. All patients started therapy with conventional synthetic DMARDs (including methotrexate). Response assessment at 3rd month was evaluated by DAS28 and ACR response criteria. JAK2 mutation was correlated with different clinical and laboratory parameters of patients.

Detailed Description

PCR detection of the JAK-2 V617F mutation using ASO specific PCR Genetic marker:

The detection of jak2 V617F mutation were done by using the following primers (JAK2 Reverse: 5' CTGAATAGTCCTACAGTGTTTTCAGTTTCA 3', JAK2 Forward (specific): 5' AGCATTTGGTTTTAAATTATGGAGTATATT 3' and JAK2 Forward (internal control): 5' ATCTATAGTCATGCTGAAAGTAGGAGAAAG 3'). Cycling conditions were 35 cycles with annealing temperature 58.5oC flowed by agarose gel 2% electrophoresis for bands detections.

All patients started treatment by conventional synthetic DMARDs (including methotrexate). Response assessment at 3rd month was evaluated by DAS28 and ACR response criteria. JAK2 mutation was correlated with different clinical and laboratory parameters of patients.

The Disease Activity Score (DAS) and the DAS28 have been developed to measure disease activity in RA both in daily clinical practice as well as in clinical trials on a group as well as individual level. The DAS/DAS28 is a continuous measure of RA disease activity that combines information from swollen joints, tender joints, acute phase response and general health The DAS28 is a measure of disease activity in rheumatoid arthritis (RA). DAS stands for 'disease activity score' and the number 28 refers to the 28 joints that are examined in this assessment. questionnaires (e.g. the HAQ which assesses function), X-rays, and newer imaging techniques such as ultrasound and MRI.

The ACR20 is a composite measure defined as both improvement of 20% in the number of tender and number of swollen joints, and a 20% improvement in three of the following five criteria: patient global assessment, physician global assessment, functional ability measure [most often Health Assessment Questionnaire (HAQ)], visual analog pain scale, and erythrocyte sedimentation rate or C-reactive protein (CRP). ACR50 and ACR70 are the same instruments with improvement levels defined as 50% and 70% respectively versus 20% for ACR20.

Conditions

Response Assessment in Newly Diagnosed RA Patients at 3rd Month Was Evaluated by DAS28 and ACR in Relation to JAK Expression

Study Design

• Allocation Method: NON_RANDOMIZED
• Intervention Model: SINGLE_GROUP
• Primary Study Purpose: OTHER
• Blinding Strategy: SINGLE

Study Groups

RA patients

newly diagnosed RA will started therapy with conventional synthetic DMARDs (including methotrexate)

Group Type: EXPERIMENTAL

JAK expression

Intervention Type: DIAGNOSTIC_TEST

JAK2 assessment in blood by PCR

control

JAK2 mutation assesment by PCR

Group Type: EXPERIMENTAL

JAK expression

Intervention Type: DIAGNOSTIC_TEST

JAK2 assessment in blood by PCR

Interventions

JAK expression

JAK2 assessment in blood by PCR

Intervention Type: DIAGNOSTIC_TEST

Eligibility Criteria

Inclusion Criteria

• New case RA patients
• good liver and renal function

Exclusion Criteria

• Other autoimmune diss
• Malignancy
• Active viral infection
• pregnancy and lactation

• Minimum Eligible Age: 18 Years
• Maximum Eligible Age: 80 Years
• Eligible Sex: ALL
• Accepts Healthy Volunteers: Yes

Sponsors

Mansoura University

OTHER

Sponsor Role: lead

Responsible Party

Responsibility Role: SPONSOR

Principal Investigators

Mohamed Elbaiomy, MD

Role: STUDY_CHAIR

Mansoura University Hospital

Locations

Mansoura University Hospital

Al Mansurah, , Egypt

Countries

Egypt

Other Identifiers

R.20.11.1075

Identifier Type: -

Identifier Source: org_study_id