Trial Outcomes & Findings for Treatment Resistance Following Anti-cancer Therapies (NCT NCT04436120)

NCT ID: NCT04436120

Last Updated: 2024-12-03

Results Overview

Change in frequency is calculated by (frequency in de novo samples) - (frequency in archival samples). The frequency of each gene alteration is calculated as number of patients who harbored the alteration divided by the total number of patients in the cohort. Only gene alterations with variant allele frequency of 5% or greater were included in the analysis. Two different sequencing techniques were applied so 2 analysis sets were repeated for each cohort: targeted panel next-generation sequencing (NGS) and whole exome sequencing NGS.

Recruitment status

TERMINATED

Study phase

NA

Target enrollment

38 participants

Primary outcome timeframe

Through study completion, approximately 3 months

Results posted on

2024-12-03

Participant Flow

A total of 38 participants were enrolled into 7 cohorts. The Safety Analysis (SA) population included 36 participants who had de novo biopsy or research blood draw performed.

Participant milestones

Participant milestones
Measure
Cohort 1: Non-small Cell Lung Carcinoma (NSCLC) Monotherapy
Progressive disease on 1st line monotherapy anti-programmed cell death receptor 1 or programmed cell death ligand 1 (anti-PD-1/-L1).
Cohort 2: NSCLC Combination
Progressive disease on 1st line anti-PD-1/-L1 plus standard doublet platinum-containing regimen; or progressive disease on 1st line anti-PD-1/-L1 plus standard doublet platinum-containing regimen followed by continuation of single agent anti-PD-1/-L1.
Cohort 3: Renal Cell Carcinoma (RCC) With Clear Cell Component
Progressive disease on 2nd line monotherapy anti-PD-1/-L1; or progressive disease on 1st line combination of doublet anti-PD-1/-L1 with anti-CTLA-4; or progressive disease on 1st line combination of avelumab with axitinib or pembrolizumab with axitinib.
Cohort 4: Hormone Receptor+Human Epidermal Growth Factor Receptor 2 - Adenocarcinoma of the Breast
Progressive disease on 1st line combination of doublet palbociclib with hormonal therapy.
Cohort 5: Castrate-resistant Adenocarcinoma of the Prostate
Progressive disease on enzalutamide monotherapy.
Cohort 6: Castrate-resistant Adenocarcinoma of the Prostate
Progressive disease on abiraterone in combination with prednisone.
Cohort 7: Germline Mutated BRCA (gBRCAm) HER2- Adenocarcinoma of the Breast
Progressive disease on a poly ADP-ribose polymerase (PARP) inhibitor monotherapy in participants previously treated with chemotherapy in the neoadjuvant, adjuvant, or metastatic setting.
Overall Study
STARTED
1
4
5
11
5
11
1
Overall Study
COMPLETED
1
4
5
10
5
10
1
Overall Study
NOT COMPLETED
0
0
0
1
0
1
0

Reasons for withdrawal

Reasons for withdrawal
Measure
Cohort 1: Non-small Cell Lung Carcinoma (NSCLC) Monotherapy
Progressive disease on 1st line monotherapy anti-programmed cell death receptor 1 or programmed cell death ligand 1 (anti-PD-1/-L1).
Cohort 2: NSCLC Combination
Progressive disease on 1st line anti-PD-1/-L1 plus standard doublet platinum-containing regimen; or progressive disease on 1st line anti-PD-1/-L1 plus standard doublet platinum-containing regimen followed by continuation of single agent anti-PD-1/-L1.
Cohort 3: Renal Cell Carcinoma (RCC) With Clear Cell Component
Progressive disease on 2nd line monotherapy anti-PD-1/-L1; or progressive disease on 1st line combination of doublet anti-PD-1/-L1 with anti-CTLA-4; or progressive disease on 1st line combination of avelumab with axitinib or pembrolizumab with axitinib.
Cohort 4: Hormone Receptor+Human Epidermal Growth Factor Receptor 2 - Adenocarcinoma of the Breast
Progressive disease on 1st line combination of doublet palbociclib with hormonal therapy.
Cohort 5: Castrate-resistant Adenocarcinoma of the Prostate
Progressive disease on enzalutamide monotherapy.
Cohort 6: Castrate-resistant Adenocarcinoma of the Prostate
Progressive disease on abiraterone in combination with prednisone.
Cohort 7: Germline Mutated BRCA (gBRCAm) HER2- Adenocarcinoma of the Breast
Progressive disease on a poly ADP-ribose polymerase (PARP) inhibitor monotherapy in participants previously treated with chemotherapy in the neoadjuvant, adjuvant, or metastatic setting.
Overall Study
neither a de novo biopsy nor a research blood draw
0
0
0
1
0
1
0

Baseline Characteristics

Treatment Resistance Following Anti-cancer Therapies

Baseline characteristics by cohort

Baseline characteristics by cohort
Measure
Cohort 1: NSCLC Monotherapy
n=1 Participants
Progressive disease on 1st line monotherapy anti-PD-1/-L1.
Cohort 2: NSCLC Combination
n=4 Participants
Progressive disease on 1st line anti-PD-1/-L1 plus standard doublet platinum-containing regimen; or progressive disease on 1st line anti-PD-1/-L1 plus standard doublet platinum-containing regimen followed by continuation of single agent anti-PD-1/-L1.
Cohort 3: RCC With Clear Cell Component
n=5 Participants
Progressive disease on 2nd line monotherapy anti-PD-1/-L1; or progressive disease on 1st line combination of doublet anti-PD-1/-L1 with anti-CTLA-4; or progressive disease on 1st line combination of avelumab with axitinib or pembrolizumab with axitinib.
Cohort 4: HR+ HER2- Adenocarcinoma of the Breast
n=10 Participants
Progressive disease on 1st line combination of doublet palbociclib with hormonal therapy.
Cohort 5: Castrate-resistant Adenocarcinoma of the Prostate
n=5 Participants
Progressive disease on enzalutamide monotherapy.
Cohort 6: Castrate-resistant Adenocarcinoma of the Prostate
n=10 Participants
Progressive disease on abiraterone in combination with prednisone.
Cohort 7: gBRCAm HER2- Adenocarcinoma of the Breast
n=1 Participants
Progressive disease on a PARP inhibitor monotherapy in participants previously treated with chemotherapy in the neoadjuvant, adjuvant, or metastatic setting.
Total
n=36 Participants
Total of all reporting groups
Age, Continuous
73.0 Years
n=5 Participants
70.8 Years
STANDARD_DEVIATION 6.90 • n=7 Participants
65.0 Years
STANDARD_DEVIATION 9.11 • n=5 Participants
66.6 Years
STANDARD_DEVIATION 6.88 • n=4 Participants
76.0 Years
STANDARD_DEVIATION 9.85 • n=21 Participants
64.7 Years
STANDARD_DEVIATION 6.62 • n=8 Participants
43.0 Years
n=8 Participants
67.1 Years
STANDARD_DEVIATION 8.99 • n=24 Participants
Sex: Female, Male
Female
0 Participants
n=5 Participants
0 Participants
n=7 Participants
1 Participants
n=5 Participants
10 Participants
n=4 Participants
0 Participants
n=21 Participants
0 Participants
n=8 Participants
1 Participants
n=8 Participants
12 Participants
n=24 Participants
Sex: Female, Male
Male
1 Participants
n=5 Participants
4 Participants
n=7 Participants
4 Participants
n=5 Participants
0 Participants
n=4 Participants
5 Participants
n=21 Participants
10 Participants
n=8 Participants
0 Participants
n=8 Participants
24 Participants
n=24 Participants
Ethnicity (NIH/OMB)
Hispanic or Latino
1 Participants
n=5 Participants
0 Participants
n=7 Participants
1 Participants
n=5 Participants
3 Participants
n=4 Participants
1 Participants
n=21 Participants
0 Participants
n=8 Participants
0 Participants
n=8 Participants
6 Participants
n=24 Participants
Ethnicity (NIH/OMB)
Not Hispanic or Latino
0 Participants
n=5 Participants
3 Participants
n=7 Participants
3 Participants
n=5 Participants
6 Participants
n=4 Participants
3 Participants
n=21 Participants
3 Participants
n=8 Participants
0 Participants
n=8 Participants
18 Participants
n=24 Participants
Ethnicity (NIH/OMB)
Unknown or Not Reported
0 Participants
n=5 Participants
1 Participants
n=7 Participants
1 Participants
n=5 Participants
1 Participants
n=4 Participants
1 Participants
n=21 Participants
7 Participants
n=8 Participants
1 Participants
n=8 Participants
12 Participants
n=24 Participants
Race/Ethnicity, Customized
White
1 Participants
n=5 Participants
4 Participants
n=7 Participants
3 Participants
n=5 Participants
10 Participants
n=4 Participants
4 Participants
n=21 Participants
6 Participants
n=8 Participants
0 Participants
n=8 Participants
28 Participants
n=24 Participants
Race/Ethnicity, Customized
Multiracial
0 Participants
n=5 Participants
0 Participants
n=7 Participants
1 Participants
n=5 Participants
0 Participants
n=4 Participants
0 Participants
n=21 Participants
0 Participants
n=8 Participants
0 Participants
n=8 Participants
1 Participants
n=24 Participants
Race/Ethnicity, Customized
Not reported
0 Participants
n=5 Participants
0 Participants
n=7 Participants
1 Participants
n=5 Participants
0 Participants
n=4 Participants
1 Participants
n=21 Participants
4 Participants
n=8 Participants
1 Participants
n=8 Participants
7 Participants
n=24 Participants

PRIMARY outcome

Timeframe: Through study completion, approximately 3 months

Population: Number of Participants Analyzed shows the number of participants with available results for the corresponding gene alterations. Data for this outcome measure was not collected for Cohorts 1,2, 3 and 7 due to early termination of the study by Sponsor. Data for Cohorts 5 and 6 was combined to report combined results for Cohorts 5 and 6, to meet the sample size was deemed sufficient to generate informative summary statistics, as pre-specified in the Study Protocol.

Change in frequency is calculated by (frequency in de novo samples) - (frequency in archival samples). The frequency of each gene alteration is calculated as number of patients who harbored the alteration divided by the total number of patients in the cohort. Only gene alterations with variant allele frequency of 5% or greater were included in the analysis. Two different sequencing techniques were applied so 2 analysis sets were repeated for each cohort: targeted panel next-generation sequencing (NGS) and whole exome sequencing NGS.

Outcome measures

Outcome measures
Measure
HR+ HER2- Adenocarcinoma of the Breast With NGS Results
n=6 Participants
Participants in Cohort 4 with progressive disease on 1st line combination of doublet palbociclib with hormonal therapy and with NGS results from pre-treatment and post-progression tumor samples available.
Castrate-resistant Adenocarcinoma of the Prostate With NGS Results
n=6 Participants
Participants in Cohort 5 \& 6 with progressive disease on enzalutamide monotherapy and on abiraterone in combination with prednisone and with NGS results from pre-treatment and post-progression tumor samples available.
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results
n=3 Participants
Participants in Cohort 4 with progressive disease on 1st line combination of doublet palbociclib with hormonal therapy and with whole exome sequencing NGS results from pre-treatment and post-progression tumor samples available.
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results
n=2 Participants
Participants in Cohort 5 \& 6 with progressive disease on enzalutamide monotherapy and on abiraterone in combination with prednisone and with whole exome sequencing NGS results from pre-treatment and post-progression tumor samples available.
Cohort 5: Castrate-resistant Adenocarcinoma of the Prostate
Progressive disease on enzalutamide monotherapy.
Cohort 6: Castrate-resistant Adenocarcinoma of the Prostate
Progressive disease on abiraterone in combination with prednisone.
Cohort 7: gBRCAm HER2- Adenocarcinoma of the Breast
Progressive disease on a PARP inhibitor monotherapy in participants previously treated with chemotherapy in the neoadjuvant, adjuvant, or metastatic setting.
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
PDZRN3 c.2348C>T
33.3 Percentage of Participants
Interval -41.5 to 79.2
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
PELP1 c.2285C>T
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
PGLYRP2 c.1711C>T
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
PHACTR1 c.1248G>A
33.3 Percentage of Participants
Interval -41.5 to 79.2
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
ARHGAP39 c.2085G>C
-16.7 Percentage of Participants
Interval -56.4 to 28.9
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
ATM c.5948A>G
0.0 Percentage of Participants
Interval -39.0 to 39.0
0.0 Percentage of Participants
Interval -39.0 to 39.0
0.0 Percentage of Participants
Interval -56.1 to 56.1
0.0 Percentage of Participants
Interval -65.8 to 65.8
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
BAP1 c.179G>A
0.0 Percentage of Participants
Interval -39.0 to 39.0
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
SYNE1 c.18758G>A
16.7 Percentage of Participants
Interval -28.9 to 56.4
33.3 Percentage of Participants
Interval -41.5 to 79.2
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
BRCA1 c.3548A>G
16.7 Percentage of Participants
Interval -28.9 to 56.4
0.0 Percentage of Participants
Interval -39.0 to 39.0
0.0 Percentage of Participants
Interval -65.8 to 65.8
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
BRCA2 c.2803G>A
0.0 Percentage of Participants
Interval -39.0 to 39.0
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
BRIP1 c.2755T>C
0.0 Percentage of Participants
Interval -39.0 to 39.0
0.0 Percentage of Participants
Interval -39.0 to 39.0
0.0 Percentage of Participants
Interval -56.1 to 56.1
0.0 Percentage of Participants
Interval -65.8 to 65.8
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
ERCC5 c.440C>G
-16.7 Percentage of Participants
Interval -56.4 to 28.9
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
ESR1 c.1613A>G
16.7 Percentage of Participants
Interval -28.9 to 56.4
33.3 Percentage of Participants
Interval -41.5 to 79.2
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
TBC1D9B c.3356A>C
16.7 Percentage of Participants
Interval -28.9 to 56.4
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
PDX1 c.172G>C
33.3 Percentage of Participants
Interval -41.5 to 79.2
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
JAK1 c.1252G>C
16.7 Percentage of Participants
Interval -28.9 to 56.4
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
LMAN1 c.823-2dupA
-16.7 Percentage of Participants
Interval -56.4 to 28.9
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
MSH6 c.116G>A
0.0 Percentage of Participants
Interval -39.0 to 39.0
0.0 Percentage of Participants
Interval -39.0 to 39.0
0.0 Percentage of Participants
Interval -56.1 to 56.1
0.0 Percentage of Participants
Interval -65.8 to 65.8
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
PIK3CG c.41A>G
-16.7 Percentage of Participants
Interval -56.4 to 28.9
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
PLCG2 c.2011A>G
16.7 Percentage of Participants
Interval -28.9 to 56.4
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
PMS2 c.1454C>A
0.0 Percentage of Participants
Interval -39.0 to 39.0
0.0 Percentage of Participants
Interval -56.1 to 56.1
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
PTPN13 c.4097T>A
-16.7 Percentage of Participants
Interval -56.4 to 28.9
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
ERG c.1455_1461delCTACTAA
-16.7 Percentage of Participants
Interval -56.4 to 28.9
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
SPOP c.260A>G
0.0 Percentage of Participants
Interval -39.0 to 39.0
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
ADAMTS7 c.227G>A
33.3 Percentage of Participants
Interval -41.5 to 79.2
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
APLP1 c.1243C>T
0.0 Percentage of Participants
Interval -56.1 to 56.1
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
ARHGEF1 c.2031_2033delGCT
33.3 Percentage of Participants
Interval -41.5 to 79.2
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
ARHGEF19 c.1379C>T
33.3 Percentage of Participants
Interval -41.5 to 79.2
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
ARHGEF7 c.2072G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
ARL10 c.53C>T
33.3 Percentage of Participants
Interval -41.5 to 79.2
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
ARL6IP4 c.902_904delAGA
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
C16orf47 c.329G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
C5orf60 c.770G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
C7orf31 c.931A>G
0.0 Percentage of Participants
Interval -56.1 to 56.1
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
PDE1C c.1733G>A
0.0 Percentage of Participants
Interval -56.1 to 56.1
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
CACNA1D c.26_28delAAA
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
CAD c.1429G>T
33.3 Percentage of Participants
Interval -41.5 to 79.2
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
CCDC47 c.21C>A
0.0 Percentage of Participants
Interval -56.1 to 56.1
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
PDGFRA c.1365-4C>T
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
PDGFRA c.2645G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
DNAH9 c.6584A>G
33.3 Percentage of Participants
Interval -41.5 to 79.2
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
ERFE c.467C>T
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
EVC2 c.2095A>G
33.3 Percentage of Participants
Interval -41.5 to 79.2
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
EVI5 c.1213T>A
33.3 Percentage of Participants
Interval -41.5 to 79.2
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
F8 c.3380G>A
33.3 Percentage of Participants
Interval -41.5 to 79.2
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
FAAP100 c.22G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
FAM135B c.2615G>T
33.3 Percentage of Participants
Interval -41.5 to 79.2
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
FAM160B2 c.305delC
33.3 Percentage of Participants
Interval -41.5 to 79.2
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
FAM161B c.932G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
FAM192A c.634C>T
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
FAM210B c.245A>G
33.3 Percentage of Participants
Interval -41.5 to 79.2
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
FANCA c.4232C>T
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
FASN c.4447G>A
33.3 Percentage of Participants
Interval -41.5 to 79.2
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
FASTKD3 c.20G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
FBXO33 c.101_109delAGCTGCGAC
33.3 Percentage of Participants
Interval -41.5 to 79.2
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
FBXW10 c.1573G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
FBXW12 c.174A>C
0.0 Percentage of Participants
Interval -56.1 to 56.1
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
FBXW9 c.209G>A
33.3 Percentage of Participants
Interval -41.5 to 79.2
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
FKBP15 c.3637G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
FLG c.5378G>A
0.0 Percentage of Participants
Interval -56.1 to 56.1
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
FLII c.668G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
FLNA c.6100C>T
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
FMR1 c.1544G>A
33.3 Percentage of Participants
Interval -41.5 to 79.2
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
FOXD4 c.748_749delGGinsC
33.3 Percentage of Participants
Interval -41.5 to 79.2
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
FOXN4 c.455delC
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
FRAS1 c.5732A>G
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
FRS3 c.1336_1344delACCCACCCTinsCCCCCCCCC
33.3 Percentage of Participants
Interval -41.5 to 79.2
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
FSIP2 c.18617_18618delTA
33.3 Percentage of Participants
Interval -41.5 to 79.2
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
FSTL1 c.755G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
GATAD2B c.1704G>T
33.3 Percentage of Participants
Interval -41.5 to 79.2
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
GGT7 c.1093G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
GJA9 c.595G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
GLI2 c.4672G>A
0.0 Percentage of Participants
Interval -56.1 to 56.1
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
GLRA4 c.440C>T
33.3 Percentage of Participants
Interval -41.5 to 79.2
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
GLT8D2 c.278G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
GMPPB c.887G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
GNB1 c.983C>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
GOLGA2 c.1483C>T
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
GOLGA8K c.1702G>A
33.3 Percentage of Participants
Interval -41.5 to 79.2
0.0 Percentage of Participants
Interval -65.8 to 65.8
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
GOLGA8K c.962A>C
33.3 Percentage of Participants
Interval -41.5 to 79.2
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
GOLM1 c.179G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
GPR50 c.514G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
GPR83 c.321C>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
GPR88 c.568G>A
33.3 Percentage of Participants
Interval -41.5 to 79.2
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
GRIA3 c.1913G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
GRIA3 c.2431G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
GRK7 c.1027G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
GRK7 c.146G>A
0.0 Percentage of Participants
Interval -56.1 to 56.1
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
PDGFRB c.2183+1G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
GRN c.266C>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
GSE1 c.1201G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
GSG2 c.611G>A
33.3 Percentage of Participants
Interval -41.5 to 79.2
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
GTPBP1 c.1339C>T
33.3 Percentage of Participants
Interval -41.5 to 79.2
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
GYG2 c.910C>T
0.0 Percentage of Participants
Interval -56.1 to 56.1
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
HCFC1 c.4873G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
HCN1 c.808C>T
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
HDDC2 c.385G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
HDLBP c.1417C>T
33.3 Percentage of Participants
Interval -41.5 to 79.2
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
HEPHL1 c.3193G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
HES2 c.13C>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
HGSNAT c.1622C>T
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
HINT3 c.10G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
HIP1 c.2956G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
HIST1H2AL c.186G>C
33.3 Percentage of Participants
Interval -41.5 to 79.2
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
HIST2H3D c.19A>C
33.3 Percentage of Participants
Interval -41.5 to 79.2
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
HJURP c.520G>T
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
HMGA2 c.275C>T
0.0 Percentage of Participants
Interval -56.1 to 56.1
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
HNRNPUL2 c.206G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
HOXB9 c.232T>C
33.3 Percentage of Participants
Interval -41.5 to 79.2
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
HOXD4 c.121G>A
33.3 Percentage of Participants
Interval -41.5 to 79.2
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
HRG c.988G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
HUNK c.1708C>T
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
HUWE1 c.11869C>A
33.3 Percentage of Participants
Interval -41.5 to 79.2
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
HYDIN c.10541G>A
0.0 Percentage of Participants
Interval -56.1 to 56.1
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
ICAM3 c.869G>A
0.0 Percentage of Participants
Interval -56.1 to 56.1
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
IFI30 c.34C>T
33.3 Percentage of Participants
Interval -41.5 to 79.2
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
IFNA10 c.178C>T
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
IFT81 c.1313G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
IGFN1 c.5179G>A
33.3 Percentage of Participants
Interval -41.5 to 79.2
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
IGFN1 c.5683T>G
33.3 Percentage of Participants
Interval -41.5 to 79.2
0.0 Percentage of Participants
Interval -81.1 to 81.1
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
IGFN1 c.5695G>A
33.3 Percentage of Participants
Interval -41.5 to 79.2
0.0 Percentage of Participants
Interval -81.1 to 81.1
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
IGSF9B c.932G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
IL12RB1 c.1097C>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
INA c.41_43delCCT
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
INTS9 c.1412G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
IQGAP2 c.4025G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
ITGAE c.1350_1352delGGC
33.3 Percentage of Participants
Interval -41.5 to 79.2
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
ITIH5 c.2035C>T
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
ITLN2 c.176G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
ITPK1 c.625G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
JMJD7 c.889G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
JPH3 c.1412C>T
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
JPH3 c.1688G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
JSRP1 c.548C>T
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
KANK3 c.304G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
KCNG1 c.1226C>T
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
KDM6A c.3068G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
KIAA0586 c.397C>T
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
KIAA1109 c.3686C>T
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
KIAA1324 c.1453G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
KIF1C c.2522C>T
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
KIF21B c.4303G>A
33.3 Percentage of Participants
Interval -41.5 to 79.2
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
KIR2DS4 c.436A>T
33.3 Percentage of Participants
Interval -41.5 to 79.2
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
KLK2 c.259G>A
33.3 Percentage of Participants
Interval -41.5 to 79.2
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
KMT2A c.5755G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
KMT2B c.265G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
KNDC1 c.3065C>T
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
KRBA1 c.1058C>T
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
LAMA5 c.104C>T
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
LEMD3 c.1873C>T
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
LINC00452 c.718G>A
33.3 Percentage of Participants
Interval -41.5 to 79.2
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
LMNA c.356G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
LMTK3 c.1696G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
LOC100506388 c.217C>T
33.3 Percentage of Participants
Interval -41.5 to 79.2
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
LOC441155 c.35dupT
33.3 Percentage of Participants
Interval -41.5 to 79.2
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
LPAR2 c.733A>G
33.3 Percentage of Participants
Interval -41.5 to 79.2
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
LRP1 c.4006G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
LRRC32 c.1573C>T
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
LRRC56 c.899G>A
33.3 Percentage of Participants
Interval -41.5 to 79.2
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
LRRC8D c.914A>G
33.3 Percentage of Participants
Interval -41.5 to 79.2
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
MADD c.2251G>A
33.3 Percentage of Participants
Interval -41.5 to 79.2
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
MAEL c.329T>C
0.0 Percentage of Participants
Interval -56.1 to 56.1
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
MAGEA10 c.145C>T
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
MAGEA5 c.181C>T
0.0 Percentage of Participants
Interval -56.1 to 56.1
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
MARCH2 c.275G>T
33.3 Percentage of Participants
Interval -41.5 to 79.2
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
MAT1A c.280G>C
33.3 Percentage of Participants
Interval -41.5 to 79.2
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
MCCC1 c.667G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
MCM6 c.1693C>T
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
MED12L c.5813C>T
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
MED23 c.2836C>T
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
MIGA2 c.508G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
MLIP c.1145C>A
33.3 Percentage of Participants
Interval -41.5 to 79.2
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
MMAB c.733G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
MMP16 c.391C>T
33.3 Percentage of Participants
Interval -41.5 to 79.2
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
MMP24 c.119_121delTGC
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
MNT c.362C>T
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
MST1R c.931delG
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
MTRNR2L3 c.2T>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
MUC12 c.9229C>A
33.3 Percentage of Participants
Interval -41.5 to 79.2
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
MUC16 c.1031G>A
33.3 Percentage of Participants
Interval -41.5 to 79.2
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
MUC19 c.18689G>C
33.3 Percentage of Participants
Interval -41.5 to 79.2
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
MUC4 c.7666G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
MUC4 c.8866G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
MUT c.1532G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
MYBPC2 c.3193G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
MYH13 c.1440C>G
33.3 Percentage of Participants
Interval -41.5 to 79.2
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
MYH9 c.4049_4051delAGG
33.3 Percentage of Participants
Interval -41.5 to 79.2
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
MYLK3 c.1105C>A
0.0 Percentage of Participants
Interval -56.1 to 56.1
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
MYO7A c.1091delC
33.3 Percentage of Participants
Interval -41.5 to 79.2
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
NANOS1 c.517G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
NCAPG2 c.2617C>T
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
NCS1 c.250G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
NFASC c.1747G>A
33.3 Percentage of Participants
Interval -41.5 to 79.2
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
NISCH c.4270C>T
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
NKX2-5 c.211G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
NLGN4X c.166C>T
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
NLRP3 c.226G>A
33.3 Percentage of Participants
Interval -41.5 to 79.2
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
NOC2L c.994G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
NOMO2 c.976G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
NOTCH1 c.1892A>G
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
NPHS1 c.3250delG
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
NUFIP1 c.415A>T
33.3 Percentage of Participants
Interval -41.5 to 79.2
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
NUP210 c.1159C>T
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
OBSCN c.11180G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
OBSL1 c.4294C>T
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
OGDHL c.2591-11_2600delTGGTCCCTCAGGGACCAGCTT
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
OR8G5 c.716G>A
33.3 Percentage of Participants
Interval -41.5 to 79.2
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
OSBPL2 c.543delC
33.3 Percentage of Participants
Interval -41.5 to 79.2
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
OVOL1 c.755C>T
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
PACS2 c.2428G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
PADI2 c.95C>T
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
PALD1 c.1525G>T
33.3 Percentage of Participants
Interval -41.5 to 79.2
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
PARD3 c.3457C>T
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
PCCB c.372G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
PCDH9 c.3533C>T
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
PCDHB13 c.1966G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
PCNX3 c.5516_5534delACTGTAGTGGGGGCGGTGG
0.0 Percentage of Participants
Interval -56.1 to 56.1
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
PCSK4 c.328C>T
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
PCSK5 c.1543A>G
33.3 Percentage of Participants
Interval -41.5 to 79.2
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
PDE12 c.806_807delTG
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
PDE1B c.1220C>T
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
PHF8 c.1499G>A
33.3 Percentage of Participants
Interval -41.5 to 79.2
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
PHLPP2 c.2843G>T
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
PI4KA c.5701G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
PID1 c.473C>G
33.3 Percentage of Participants
Interval -41.5 to 79.2
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
PIDD1 c.992A>G
33.3 Percentage of Participants
Interval -41.5 to 79.2
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
PIEZO1 c.3107G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
PIGG c.1087C>T
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
PIGG c.2061G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
PIN1 c.220C>T
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
PITPNC1 c.527G>T
33.3 Percentage of Participants
Interval -41.5 to 79.2
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
PKHD1 c.5814G>T
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
PLCB1 c.2279G>A
33.3 Percentage of Participants
Interval -41.5 to 79.2
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
PLEK2 c.458G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
PLEKHA5 c.1070C>T
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
PLEKHG1 c.2273G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
PLEKHM1 c.2174G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
PNPT1 c.1285-3_1288delAAGTTTCinsTTTTTTT
33.3 Percentage of Participants
Interval -41.5 to 79.2
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
PODXL2 c.1217G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
POLR2A c.1492G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
POM121C c.1456A>T
33.3 Percentage of Participants
Interval -41.5 to 79.2
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
POMT1 c.1648C>T
33.3 Percentage of Participants
Interval -41.5 to 79.2
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
POTEF c.505C>A
33.3 Percentage of Participants
Interval -41.5 to 79.2
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
POU3F3 c.259G>A
0.0 Percentage of Participants
Interval -56.1 to 56.1
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
PPEF1 c.735C>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
PRAMEF11 c.1144A>C
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
PREP c.815G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
PRR14L c.3470A>G
33.3 Percentage of Participants
Interval -41.5 to 79.2
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
PRSS55 c.43G>A
33.3 Percentage of Participants
Interval -41.5 to 79.2
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
PTPRS c.2192C>T
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
PTPRS c.2872C>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
QRICH2 c.3259G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
QSOX2 c.994C>T
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
R3HCC1 c.309-1G>A
33.3 Percentage of Participants
Interval -41.5 to 79.2
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
RAB21 c.41_43delCGG
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
RAD50 c.1684G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
RAD54L2 c.1012A>G
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
RAPH1 c.1993G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
RASAL3 c.2062G>A
33.3 Percentage of Participants
Interval -41.5 to 79.2
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
RASAL3 c.2155G>C
33.3 Percentage of Participants
Interval -41.5 to 79.2
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
RASGRF2 c.123G>C
33.3 Percentage of Participants
Interval -41.5 to 79.2
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
RASGRP4 c.1501G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
RB1 c.2359C>T
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
RBL1 c.294A>T
33.3 Percentage of Participants
Interval -41.5 to 79.2
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
RBM25 c.1438G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
RBM43 c.167C>T
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
RBMXL3 c.1307G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
RBPMS c.50A>G
0.0 Percentage of Participants
Interval -56.1 to 56.1
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
RFPL2 c.1018_1021delTTGCinsCTGT
33.3 Percentage of Participants
Interval -41.5 to 79.2
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
RFPL2 c.970A>G
33.3 Percentage of Participants
Interval -41.5 to 79.2
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
RGPD3 c.2468A>T
33.3 Percentage of Participants
Interval -41.5 to 79.2
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
RGS20 c.1145C>T
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
RIMS4 c.597G>T
33.3 Percentage of Participants
Interval -41.5 to 79.2
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
RIMS4 c.730G>C
0.0 Percentage of Participants
Interval -56.1 to 56.1
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
ZAR1 c.1145C>T
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
RIOK3 c.1010C>T
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
RNASEL c.1419A>T
0.0 Percentage of Participants
Interval -56.1 to 56.1
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
RNF114 c.680A>T
33.3 Percentage of Participants
Interval -41.5 to 79.2
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
RNF123 c.3932C>T
33.3 Percentage of Participants
Interval -41.5 to 79.2
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
RNF185 c.254G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
RNF185 c.558G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
RNF214 c.412G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
RNH1 c.433G>T
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
RPAP3 c.1011delA
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
RPL18 c.335G>A
33.3 Percentage of Participants
Interval -41.5 to 79.2
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
RPL4 c.427C>T
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
RPS6KA2 c.1756G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
RPS6KB2 c.37G>A
33.3 Percentage of Participants
Interval -41.5 to 79.2
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
RRBP1 c.2335G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
RTN1 c.1600C>A
0.0 Percentage of Participants
Interval -56.1 to 56.1
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
RTP5 c.281G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
RUNDC1 c.337C>T
33.3 Percentage of Participants
Interval -41.5 to 79.2
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
RXFP2 c.604C>T
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
SACS c.2488G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
SALL3 c.1837G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
SAMHD1 c.405_421delCATTGATACACCTCAAT
0.0 Percentage of Participants
Interval -56.1 to 56.1
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
SAP30L c.193G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
SAPCD1 c.119G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
SBSN c.1583A>T
0.0 Percentage of Participants
Interval -56.1 to 56.1
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
SCAP c.2892delC
33.3 Percentage of Participants
Interval -41.5 to 79.2
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
SEC14L1 c.1129C>T
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
SEC14L4 c.287G>T
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
SEC24D c.907G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
SH2D3C c.898C>T
33.3 Percentage of Participants
Interval -41.5 to 79.2
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
SIGLEC9 c.17_19delTGC
33.3 Percentage of Participants
Interval -41.5 to 79.2
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
SIRPG c.1141G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
SLC22A8 c.583G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
SLC26A4 c.575T>C
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
SLC2A5 c.964G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
SLC2A6 c.961G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
SLC2A8 c.576delC
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
SLC35F1 c.703G>A
0.0 Percentage of Participants
Interval -56.1 to 56.1
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
SLC5A10 c.1211G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
SLC6A13 c.1341C>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
SLC8A1 c.2011A>T
0.0 Percentage of Participants
Interval -56.1 to 56.1
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
SLC8A3 c.2374G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
SLIT3 c.182G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
SMARCA4 c.4185delA
33.3 Percentage of Participants
Interval -41.5 to 79.2
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
SMARCAD1 c.1637G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
SOBP c.1950G>T
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
SOGA1 c.1477G>T
0.0 Percentage of Participants
Interval -56.1 to 56.1
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
SOST c.278C>A
33.3 Percentage of Participants
Interval -41.5 to 79.2
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
SOX18 c.698C>T
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
SP140 c.2167G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
SP8 c.326G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
SPATA31A6 c.1997A>G
33.3 Percentage of Participants
Interval -41.5 to 79.2
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
SPATA31E1 c.2987G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
SPINK2 c.118A>G
33.3 Percentage of Participants
Interval -41.5 to 79.2
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
SPIRE2 c.470_472delAGG
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
SPOCD1 c.3199G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
SREBF2 c.85G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
SSC4D c.1154C>T
33.3 Percentage of Participants
Interval -41.5 to 79.2
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
SSH2 c.2626G>C
0.0 Percentage of Participants
Interval -56.1 to 56.1
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
SSPO c.13487A>G
33.3 Percentage of Participants
Interval -41.5 to 79.2
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
SSPO c.1967G>T
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
SSTR1 c.121C>T
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
STAC3 c.226_227insGGG
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
STK26 c.1073C>T
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
STK33 c.1280G>C
33.3 Percentage of Participants
Interval -41.5 to 79.2
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
STK38L c.148G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
STK40 c.1198G>A
33.3 Percentage of Participants
Interval -41.5 to 79.2
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
STT3B c.957T>G
33.3 Percentage of Participants
Interval -41.5 to 79.2
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
SUDS3 c.397_399delAAG
33.3 Percentage of Participants
Interval -41.5 to 79.2
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
SUSD3 c.428C>T
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
SYCP2 c.4180C>T
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
SYN2 c.544G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
SYNE2 c.9263G>A
33.3 Percentage of Participants
Interval -41.5 to 79.2
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
TACC2 c.2488C>T
33.3 Percentage of Participants
Interval -41.5 to 79.2
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
TACC2 c.3196G>A
33.3 Percentage of Participants
Interval -41.5 to 79.2
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
TACC3 c.1847C>T
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
TAF1D c.281delA
33.3 Percentage of Participants
Interval -41.5 to 79.2
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
TBL1X c.826C>T
33.3 Percentage of Participants
Interval -41.5 to 79.2
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
TEKT4 c.824G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
TEX264 c.875G>A
33.3 Percentage of Participants
Interval -41.5 to 79.2
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
TFAP2E c.305C>T
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
TGM4 c.937G>A
33.3 Percentage of Participants
Interval -41.5 to 79.2
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
THEMIS2 c.1527_1531delTGTGAinsCGTGG
33.3 Percentage of Participants
Interval -41.5 to 79.2
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
TIGD4 c.373G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
TLN1 c.7088C>T
33.3 Percentage of Participants
Interval -41.5 to 79.2
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
TMC6 c.2054G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
TMCO6 c.464T>A
0.0 Percentage of Participants
Interval -56.1 to 56.1
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
TMEM151A c.3G>A
33.3 Percentage of Participants
Interval -41.5 to 79.2
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
TMEM165 c.703C>G
33.3 Percentage of Participants
Interval -41.5 to 79.2
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
TMEM200B c.338G>T
33.3 Percentage of Participants
Interval -41.5 to 79.2
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
TMEM232 c.1045G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
TMEM237 c.1159G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
TMEM59L c.800G>A
33.3 Percentage of Participants
Interval -41.5 to 79.2
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
TMEM63C c.2128C>T
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
TMEM70 c.113G>T
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
TMEM94 c.859G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
TNFSF18 c.355A>G
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
TNRC18 c.3076A>C
33.3 Percentage of Participants
Interval -41.5 to 79.2
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
TNRC6B c.4934G>A
0.0 Percentage of Participants
Interval -56.1 to 56.1
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
TOGARAM1 c.2390A>C
0.0 Percentage of Participants
Interval -56.1 to 56.1
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
TOP2B c.1057C>G
0.0 Percentage of Participants
Interval -56.1 to 56.1
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
TOP2B c.247G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
TPR c.583A>G
0.0 Percentage of Participants
Interval -56.1 to 56.1
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
TRDN c.1900G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
TRIM61 c.365C>G
33.3 Percentage of Participants
Interval -41.5 to 79.2
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
TRIM64B c.377delG
33.3 Percentage of Participants
Interval -41.5 to 79.2
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
TRPV1 c.1753A>G
33.3 Percentage of Participants
Interval -41.5 to 79.2
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
TSEN2 c.247C>G
0.0 Percentage of Participants
Interval -56.1 to 56.1
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
TSEN2 c.451G>A
0.0 Percentage of Participants
Interval -56.1 to 56.1
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
TSEN2 c.506G>A
0.0 Percentage of Participants
Interval -56.1 to 56.1
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
TTK c.1324_1327delTCTA
33.3 Percentage of Participants
Interval -41.5 to 79.2
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
TTN c.68658G>C
33.3 Percentage of Participants
Interval -41.5 to 79.2
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
TTN c.68716C>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
TULP4 c.4571C>T
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
TXNRD2 c.1522C>T
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
UBASH3B c.32G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
UBE4A c.2306G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
USP32 c.2804G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
USPL1 c.3256G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
VGLL2 c.794C>T
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
WDFY3 c.1262T>C
0.0 Percentage of Participants
Interval -56.1 to 56.1
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
XKR4 c.1918A>T
33.3 Percentage of Participants
Interval -41.5 to 79.2
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
XPO4 c.238C>T
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
XPO7 c.2398C>T
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
ZC3H12B c.2285G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
ZC3H12D c.1213C>T
33.3 Percentage of Participants
Interval -41.5 to 79.2
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
ZC3H7B c.1569C>G
33.3 Percentage of Participants
Interval -41.5 to 79.2
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
ZC3H8 c.220G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
ZDBF2 c.5228C>T
33.3 Percentage of Participants
Interval -41.5 to 79.2
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
ZMPSTE24 c.1085dupT
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
ZMYM1 c.1965G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
ZMYM5 c.74C>T
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
ZMYND15 c.1468G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
ZNF10 c.1658C>T
0.0 Percentage of Participants
Interval -56.1 to 56.1
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
ZNF207 c.673A>G
33.3 Percentage of Participants
Interval -41.5 to 79.2
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
ZNF208 c.766T>C
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
ZNF276 c.548C>T
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
ZNF365 c.307G>A
0.0 Percentage of Participants
Interval -56.1 to 56.1
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
ZNF367 c.854G>A
33.3 Percentage of Participants
Interval -41.5 to 79.2
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
ZNF37A c.1369C>T
33.3 Percentage of Participants
Interval -41.5 to 79.2
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
ZNF383 c.820C>T
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
ZNF420 c.34G>T
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
ZNF431 c.1260G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
ZNF431 c.1525G>C
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
ZNF474 c.757C>T
0.0 Percentage of Participants
Interval -56.1 to 56.1
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
ZNF493 c.802G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
ZNF536 c.3551A>C
33.3 Percentage of Participants
Interval -41.5 to 79.2
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
ZNF568 c.1066C>A
0.0 Percentage of Participants
Interval -56.1 to 56.1
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
ZNF680 c.1016A>G
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
ZNF696 c.430C>T
33.3 Percentage of Participants
Interval -41.5 to 79.2
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
ZNF782 c.1630G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
ZNFX1 c.1982C>T
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
ZP1 c.1103G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
ZYX c.697C>T
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
ABCA5 c.725_727delCAGinsAAA
50.0 Percentage of Participants
Interval -48.6 to 90.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
ACSF3 c.1180C>A
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
ADAMTS2 c.2243C>T
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
ADCK2 c.253C>T
0.0 Percentage of Participants
Interval -65.8 to 65.8
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
ADGRA1 c.227G>A
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
ADGRF3 c.1615G>A
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
ADGRG2 c.1314C>A
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
ADGRV1 c.16006C>A
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
AFAP1 c.140A>G
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
AHNAK c.14273A>G
0.0 Percentage of Participants
Interval -65.8 to 65.8
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
AHRR c.1881C>A
0.0 Percentage of Participants
Interval -65.8 to 65.8
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
AKAP13 c.5222C>A
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
AKR1B15 c.452delT
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
ALS2CR12 c.1079C>A
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
ALX3 c.226G>A
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
AMOTL2 c.2426G>A
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
ANK3 c.9349dupA
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
ANKRD33 c.112G>A
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
ANXA10 c.655G>T
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
AP4B1 c.1657G>A
50.0 Percentage of Participants
Interval -48.6 to 90.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
APPBP2 c.863C>A
50.0 Percentage of Participants
Interval -48.6 to 90.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
ARHGAP6 c.1393G>C
0.0 Percentage of Participants
Interval -65.8 to 65.8
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
ARID1A c.492_494delCGC
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
ARMC12 c.829G>A
0.0 Percentage of Participants
Interval -65.8 to 65.8
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
ARSE c.1750C>A
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
ATM c.458G>T
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
ATM c.6889C>G
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
ATP10D c.545G>T
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
ATXN3 c.911_912insACAGCAGCAGCAGCAGCAGCAGCA
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
ATXN7 c.59_61delCGG
50.0 Percentage of Participants
Interval -48.6 to 90.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
BCR c.3055G>A
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
BRIX1 c.494T>C
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
GKAP1 c.424G>A
50.0 Percentage of Participants
Interval -48.6 to 90.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
BTG2 c.17G>A
50.0 Percentage of Participants
Interval -48.6 to 90.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
C10orf76 c.1715T>C
0.0 Percentage of Participants
Interval -65.8 to 65.8
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
C10orf82 c.343G>T
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
C10orf95 c.581G>A
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
C12orf56 c.989A>G
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
CCDC114 c.601A>G
50.0 Percentage of Participants
Interval -48.6 to 90.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
CCDC168 c.15025G>A
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
CCDC25 c.137C>A
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
CCDC93 c.1321G>T
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
CCNL2 c.532A>G
0.0 Percentage of Participants
Interval -65.8 to 65.8
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
CECR2 c.3651_3655dupAACCC
0.0 Percentage of Participants
Interval -65.8 to 65.8
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
CELSR1 c.5418G>T
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
CEP85L c.11G>T
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
CFAP97 c.481delA
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
CIZ1 c.346C>A
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
CLCN1 c.2435_2445delAGCCTGTCTGT
50.0 Percentage of Participants
Interval -48.6 to 90.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
CLEC18C c.299T>C
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
CLN5 c.272C>T
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
CNOT1 c.4630_4635delCTGTTAinsTTTTTT
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
CNTN6 c.2759G>A
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
COL11A2 c.2102C>T
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
COL27A1 c.1908G>A
50.0 Percentage of Participants
Interval -48.6 to 90.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
CP c.2291C>T
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
CPB2 c.340delC
50.0 Percentage of Participants
Interval -48.6 to 90.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
CYP11B2 c.1471C>A
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
DCC c.601C>T
50.0 Percentage of Participants
Interval -48.6 to 90.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
DHRS2 c.287A>T
0.0 Percentage of Participants
Interval -65.8 to 65.8
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
DHX29 c.3296C>A
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
DSC2 c.934G>T
0.0 Percentage of Participants
Interval -65.8 to 65.8
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
DST c.4384G>T
0.0 Percentage of Participants
Interval -65.8 to 65.8
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
EPG5 c.6263T>G
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
EREG c.143G>A
0.0 Percentage of Participants
Interval -65.8 to 65.8
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
F13A1 c.1909-883_2038dup
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
FIG4 c.2586A>T
0.0 Percentage of Participants
Interval -65.8 to 65.8
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
IGFN1 c.5612A>G
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
KMT5C c.1141dupC
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
LMO7 c.1315T>C
50.0 Percentage of Participants
Interval -48.6 to 90.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
LOC100505841 c.50G>A
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
LONRF3 c.712C>A
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
LRP2 c.13139dupC
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
LRRC4 c.912_913delTG
50.0 Percentage of Participants
Interval -48.6 to 90.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
LRRC40 c.1457C>T
50.0 Percentage of Participants
Interval -48.6 to 90.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
LRRK1 c.644G>A
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
LTBP1 c.307C>T
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
MADD c.3458C>T
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
MAP2K2 c.1069C>T
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
MAZ c.272C>T
50.0 Percentage of Participants
Interval -48.6 to 90.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
MED21 c.35T>G
0.0 Percentage of Participants
Interval -65.8 to 65.8
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
MED23 c.2276dupA
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
METTL5 c.388G>A
0.0 Percentage of Participants
Interval -65.8 to 65.8
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
MICALL1 c.2475C>A
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
MIER3 c.1113delG
0.0 Percentage of Participants
Interval -65.8 to 65.8
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
MMP2 c.1484G>A
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
MMP24 c.170_172delCGG
50.0 Percentage of Participants
Interval -48.6 to 90.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
MRVI1 c.1446delA
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
MUC12 c.13432C>A
50.0 Percentage of Participants
Interval -48.6 to 90.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
MUC12 c.2740T>C
50.0 Percentage of Participants
Interval -48.6 to 90.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
MUC12 c.4291G>A
50.0 Percentage of Participants
Interval -48.6 to 90.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
MUC12 c.5512C>A
50.0 Percentage of Participants
Interval -48.6 to 90.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
TMEM26 c.709G>T
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
TMPO c.514A>G
0.0 Percentage of Participants
Interval -65.8 to 65.8
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
USP34 c.1142C>A
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
WASHC2C c.691G>T
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
WDR33 c.160C>T
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
ZNF185 c.1222G>A
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
CTNNB1 c.1517T>A
33.3 Percentage of Participants
Interval -41.5 to 79.2
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
CTH c.589C>T
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
CST9 c.289C>T
33.3 Percentage of Participants
Interval -41.5 to 79.2
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
CTTNBP2 c.3100G>A
33.3 Percentage of Participants
Interval -41.5 to 79.2
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
AKT1 c.238T>C
16.7 Percentage of Participants
Interval -28.9 to 56.4
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
ARHGAP39 c.2000G>A
16.7 Percentage of Participants
Interval -28.9 to 56.4
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
ARID1A c.3145_3146dupCT
0.0 Percentage of Participants
Interval -39.0 to 39.0
0.0 Percentage of Participants
Interval -56.1 to 56.1
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
ARID1A c.3977dupC
0.0 Percentage of Participants
Interval -39.0 to 39.0
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
ARID2 c.1803dupG
0.0 Percentage of Participants
Interval -39.0 to 39.0
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
ASXL1 c.1934dupG
16.7 Percentage of Participants
Interval -28.9 to 56.4
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
ATM c.5557G>A
0.0 Percentage of Participants
Interval -39.0 to 39.0
0.0 Percentage of Participants
Interval -56.1 to 56.1
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
AXIN1 c.1881G>T
16.7 Percentage of Participants
Interval -28.9 to 56.4
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
CT55 c.331A>T
33.3 Percentage of Participants
Interval -41.5 to 79.2
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
CTAGE4 c.1963A>G
33.3 Percentage of Participants
Interval -41.5 to 79.2
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
CTBP1 c.1130C>T
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
CX3CL1 c.1130C>T
33.3 Percentage of Participants
Interval -41.5 to 79.2
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
BCLAF1 c.615_619delATCAGinsGTCAT
16.7 Percentage of Participants
Interval -28.9 to 56.4
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
CXCR3 c.386G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
CYBA c.437G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
CYBB c.1461G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
CYGB c.406G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
BCOR c.476C>A
16.7 Percentage of Participants
Interval -28.9 to 56.4
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
BRCA1 c.2612C>T
16.7 Percentage of Participants
Interval -28.9 to 56.4
0.0 Percentage of Participants
Interval -39.0 to 39.0
0.0 Percentage of Participants
Interval -65.8 to 65.8
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
CYP2F1 c.1028G>A
33.3 Percentage of Participants
Interval -41.5 to 79.2
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
DAAM1 c.1015C>T
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
DAB2 c.2173C>A
33.3 Percentage of Participants
Interval -41.5 to 79.2
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
DACH1 c.1726C>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
BRCA1 c.3113A>G
16.7 Percentage of Participants
Interval -28.9 to 56.4
0.0 Percentage of Participants
Interval -39.0 to 39.0
0.0 Percentage of Participants
Interval -65.8 to 65.8
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
BRCA1 c.4837A>G
16.7 Percentage of Participants
Interval -28.9 to 56.4
0.0 Percentage of Participants
Interval -39.0 to 39.0
0.0 Percentage of Participants
Interval -65.8 to 65.8
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
BRCA1 c.4956G>A
0.0 Percentage of Participants
Interval -39.0 to 39.0
0.0 Percentage of Participants
Interval -39.0 to 39.0
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
BRCA2 c.1114A>C
0.0 Percentage of Participants
Interval -39.0 to 39.0
0.0 Percentage of Participants
Interval -39.0 to 39.0
0.0 Percentage of Participants
Interval -56.1 to 56.1
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
BRCA2 c.7397T>C
0.0 Percentage of Participants
Interval -39.0 to 39.0
0.0 Percentage of Participants
Interval -39.0 to 39.0
0.0 Percentage of Participants
Interval -56.1 to 56.1
0.0 Percentage of Participants
Interval -65.8 to 65.8
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
BRCA2 c.9976A>T
0.0 Percentage of Participants
Interval -39.0 to 39.0
0.0 Percentage of Participants
Interval -56.1 to 56.1
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
BRIP1 c.14G>C
-16.7 Percentage of Participants
Interval -56.4 to 28.9
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
CBR3 c.730G>A
16.7 Percentage of Participants
Interval -28.9 to 56.4
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
CCNE1 c.1117G>A
-16.7 Percentage of Participants
Interval -56.4 to 28.9
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
CD22 c.757G>T
-16.7 Percentage of Participants
Interval -56.4 to 28.9
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
CD3EAP c.1516C>A
16.7 Percentage of Participants
Interval -28.9 to 56.4
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
CDH1 c.1269delT
0.0 Percentage of Participants
Interval -39.0 to 39.0
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
CDH1 c.466T>A
0.0 Percentage of Participants
Interval -39.0 to 39.0
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
CREBBP c.1792C>T
16.7 Percentage of Participants
Interval -28.9 to 56.4
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
CSF3R c.14G>T
0.0 Percentage of Participants
Interval -39.0 to 39.0
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
DNM2 c.1782-5delC
0.0 Percentage of Participants
Interval -39.0 to 39.0
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
DPYD c.1471G>T
16.7 Percentage of Participants
Interval -28.9 to 56.4
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
DYNC2H1 c.1714A>G
-16.7 Percentage of Participants
Interval -56.4 to 28.9
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
ECH1 c.122A>C
16.7 Percentage of Participants
Interval -28.9 to 56.4
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
ERBB2 c.1958C>G
16.7 Percentage of Participants
Interval -28.9 to 56.4
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
ERBB2 c.2446C>T
-16.7 Percentage of Participants
Interval -56.4 to 28.9
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
ESR1 c.1609T>A
16.7 Percentage of Participants
Interval -28.9 to 56.4
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
ESR1 c.1610_1613delATGAinsGTGG
16.7 Percentage of Participants
Interval -28.9 to 56.4
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
FAM175A c.826_828delGAG
-16.7 Percentage of Participants
Interval -56.4 to 28.9
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
FANCA c.2426G>A
16.7 Percentage of Participants
Interval -28.9 to 56.4
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
FANCD2 c.1214A>G
-16.7 Percentage of Participants
Interval -56.4 to 28.9
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
FANCE c.17C>G
-16.7 Percentage of Participants
Interval -16.7 to 28.9
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
FAT1 c.3818A>G
16.7 Percentage of Participants
Interval -28.9 to 56.4
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
FGF9 c.375T>A
0.0 Percentage of Participants
Interval -39.0 to 39.0
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
FGFR1 c.358+4G>A
-16.7 Percentage of Participants
Interval -56.4 to 28.9
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
FGFR1OP c.985-6_985-5dupTT
-16.7 Percentage of Participants
Interval -56.4 to 28.9
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
FLT4 c.1019G>C
16.7 Percentage of Participants
Interval -28.9 to 56.4
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
FOXA1 c.247G>A
16.7 Percentage of Participants
Interval -28.9 to 56.4
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
FOXA1 c.801G>T
0.0 Percentage of Participants
Interval -39.0 to 39.0
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
FOXA1 c.874G>T
16.7 Percentage of Participants
Interval -28.9 to 56.4
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
FOXQ1 c.1013A>G
-16.7 Percentage of Participants
Interval -56.4 to 28.9
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
FOXQ1 c.895G>A
16.7 Percentage of Participants
Interval -28.9 to 56.4
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
FRS2 c.236G>T
16.7 Percentage of Participants
Interval -28.9 to 56.4
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
GATA2 c.527C>T
0.0 Percentage of Participants
Interval -39.0 to 39.0
0.0 Percentage of Participants
Interval -56.1 to 56.1
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
GATA3 c.1223_1224insA
0.0 Percentage of Participants
Interval -39.0 to 39.0
0.0 Percentage of Participants
Interval -56.1 to 56.1
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
GNAS c.521G>A
16.7 Percentage of Participants
Interval -28.9 to 56.4
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
GOT2 c.1037T>G
16.7 Percentage of Participants
Interval -28.9 to 56.4
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
HEATR1 c.6347-4_6347-3dupTT
-16.7 Percentage of Participants
Interval -56.4 to 28.9
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
IRF2 c.744G>A
16.7 Percentage of Participants
Interval -28.9 to 56.4
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
IRS2 c.3170G>A
16.7 Percentage of Participants
Interval -28.9 to 56.4
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
ITPKB c.1222T>G
16.7 Percentage of Participants
Interval -28.9 to 56.4
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
JAK2 c.2743G>T
16.7 Percentage of Participants
Interval -28.9 to 56.4
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
JAK3 c.757A>G
16.7 Percentage of Participants
Interval -28.9 to 56.4
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
KDM6A c.2859-5delT
-16.7 Percentage of Participants
Interval -56.4 to 28.9
16.7 Percentage of Participants
Interval -28.9 to 56.4
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
KDR c.2921G>T
-16.7 Percentage of Participants
Interval -56.4 to 28.9
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
KMT2C c.2536delG
0.0 Percentage of Participants
Interval -39.0 to 39.0
0 Percentage of Participants
Interval -56.1 to 56.1
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
KMT2C c.4270C>T
16.7 Percentage of Participants
Interval -28.9 to 56.4
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
LRP1B c.143A>G
16.7 Percentage of Participants
Interval -28.9 to 56.4
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
LRP1B c.5737G>A
-16.7 Percentage of Participants
Interval -56.4 to 28.9
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
LTN1 c.1717A>G
16.7 Percentage of Participants
Interval -28.9 to 56.4
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
LYN c.475G>T
16.7 Percentage of Participants
Interval -28.9 to 56.4
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
MAP2K4 c.179C>A
-16.7 Percentage of Participants
Interval -56.4 to 28.9
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
MED12 c.1364G>T
16.7 Percentage of Participants
Interval -28.9 to 56.4
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
MGMT c.520A>G
16.7 Percentage of Participants
Interval -28.9 to 56.4
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
MGMT c.626A>G
16.7 Percentage of Participants
Interval -28.9 to 56.4
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
MLH1 c.655A>G
16.7 Percentage of Participants
Interval -28.9 to 56.4
0.0 Percentage of Participants
Interval -39.0 to 39.0
0.0 Percentage of Participants
Interval -56.1 to 56.1
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
MSH2 c.1748A>G
0.0 Percentage of Participants
Interval -39.0 to 39.0
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
MSH6 c.3557-4dupT
16.7 Percentage of Participants
Interval -28.9 to 56.4
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
MTHFR c.1286A>C
16.7 Percentage of Participants
Interval -28.9 to 56.4
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
MUTYH c.1014G>C
0.0 Percentage of Participants
Interval -39.0 to 39.0
0.0 Percentage of Participants
Interval -39.0 to 39.0
0.0 Percentage of Participants
Interval -56.1 to 56.1
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
MUTYH c.1187G>A
0.0 Percentage of Participants
Interval -39.0 to 39.0
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
MYB c.1781C>G
0.0 Percentage of Participants
Interval -39.0 to 39.0
0.0 Percentage of Participants
Interval -56.1 to 56.1
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
NBN c.553G>C
0.0 Percentage of Participants
Interval -39.0 to 39.0
-33.3 Percentage of Participants
Interval -70.0 to 18.7
0.0 Percentage of Participants
Interval -56.1 to 56.1
0.0 Percentage of Participants
Interval -65.8 to 65.8
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
NBN c.683T>G
0.0 Percentage of Participants
Interval -39.0 to 39.0
0.0 Percentage of Participants
Interval -56.1 to 56.1
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
NCOR1 c.4135G>T
0.0 Percentage of Participants
Interval -39.0 to 39.0
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
NCOR2 c.1597G>A
0.0 Percentage of Participants
Interval -39.0 to 39.0
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
NF1 c.7063-1G>T
-16.7 Percentage of Participants
Interval -56.4 to 28.9
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
NF1 c.849T>G
16.7 Percentage of Participants
Interval -28.9 to 56.4
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
NOTCH1 c.2588-4G>A
16.7 Percentage of Participants
Interval -28.9 to 56.4
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
NOTCH2 c.3522+3G>A
16.7 Percentage of Participants
Interval -28.9 to 56.4
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
NOTCH3 c.539C>T
0.0 Percentage of Participants
Interval -39.0 to 39.0
0.0 Percentage of Participants
Interval -56.1 to 56.1
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
NTRK1 c.1806-4delA
16.7 Percentage of Participants
Interval -28.9 to 56.4
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
NUP98 c.3310G>A
16.7 Percentage of Participants
Interval -28.9 to 56.4
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
PALB2 c.1676A>G
0.0 Percentage of Participants
Interval -39.0 to 39.0
0.0 Percentage of Participants
Interval -39.0 to 39.0
0.0 Percentage of Participants
Interval -56.1 to 56.1
0.0 Percentage of Participants
Interval -65.8 to 65.8
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
PALB2 c.2014G>C
0.0 Percentage of Participants
Interval -39.0 to 39.0
0.0 Percentage of Participants
Interval -39.0 to 39.0
0.0 Percentage of Participants
Interval -56.1 to 56.1
0.0 Percentage of Participants
Interval -65.8 to 65.8
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
PIK3CA c.1035T>A
0.0 Percentage of Participants
Interval -39.0 to 39.0
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
PIK3CA c.1633G>A
0.0 Percentage of Participants
Interval -39.0 to 39.0
0.0 Percentage of Participants
Interval -56.1 to 56.1
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
PIK3CA c.3140A>G
0.0 Percentage of Participants
Interval -39.0 to 39.0
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
PMS2 c.13G>C
0.0 Percentage of Participants
Interval -39.0 to 39.0
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
PMS2 c.1408C>T
0.0 Percentage of Participants
Interval -39.0 to 39.0
0.0 Percentage of Participants
Interval -39.0 to 39.0
0.0 Percentage of Participants
Interval -56.1 to 56.1
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
PMS2 c.1621A>G
0.0 Percentage of Participants
Interval -39.0 to 39.0
0.0 Percentage of Participants
Interval -39.0 to 39.0
0.0 Percentage of Participants
Interval -56.1 to 56.1
0.0 Percentage of Participants
Interval -65.8 to 65.8
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
PMS2 c.2570G>C
0.0 Percentage of Participants
Interval -39.0 to 39.0
33.3 Percentage of Participants
Interval -18.7 to 70.0
0.0 Percentage of Participants
Interval -56.1 to 56.1
50.0 Percentage of Participants
Interval -48.6 to 90.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
PMS2 c.89A>G
0.0 Percentage of Participants
Interval -39.0 to 39.0
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
POLD1 c.2959delG
-16.7 Percentage of Participants
Interval -56.4 to 28.9
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
PRKDC c.6424C>T
-16.7 Percentage of Participants
Interval -56.4 to 28.9
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
PTCH1 c.3746C>T
16.7 Percentage of Participants
Interval -28.9 to 56.4
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
PTCH2 c.2134G>A
0.0 Percentage of Participants
Interval -39.0 to 39.0
0 Percentage of Participants
Interval -56.1 to 56.1
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
PTPN13 c.5683A>T
0.0 Percentage of Participants
Interval -39.0 to 39.0
0.0 Percentage of Participants
Interval -56.1 to 56.1
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
PTPN13 c.6256T>G
16.7 Percentage of Participants
Interval -28.9 to 56.4
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
PUS3 c.1380G>C
16.7 Percentage of Participants
Interval -28.9 to 56.4
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
RAD51C c.376G>A
0.0 Percentage of Participants
Interval -39.0 to 39.0
0.0 Percentage of Participants
Interval -39.0 to 39.0
0.0 Percentage of Participants
Interval -56.1 to 56.1
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
PTEN c.900delC
-16.7 Percentage of Participants
Interval -56.4 to 28.9
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
RAD51D c.494G>A
0.0 Percentage of Participants
Interval -39.0 to 39.0
0.0 Percentage of Participants
Interval -56.1 to 56.1
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
RIT1 c.625G>C
0.0 Percentage of Participants
Interval -39.0 to 39.0
0.0 Percentage of Participants
Interval -56.1 to 56.1
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
RNF43 c.1252C>A
16.7 Percentage of Participants
Interval -28.9 to 56.4
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
ROS1 c.1775_1777delGTG
0.0 Percentage of Participants
Interval -39.0 to 39.0
0.0 Percentage of Participants
Interval -56.1 to 56.1
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
RSF1 c.3025G>C
-16.7 Percentage of Participants
Interval -56.4 to 28.9
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
SF3B1 c.2077+4A>G
16.7 Percentage of Participants
Interval -28.9 to 56.4
33.3 Percentage of Participants
Interval -41.5 to 79.2
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
SOD2 c.47T>C
16.7 Percentage of Participants
Interval -28.9 to 56.4
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
TBC1D12 c.1246C>T
-16.7 Percentage of Participants
Interval -56.4 to 28.9
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
TBX3 c.364G>A
0.0 Percentage of Participants
Interval -39.0 to 39.0
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
TBX3 c.820_827dupCCCGAAAC
0.0 Percentage of Participants
Interval -39.0 to 39.0
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
TCF3 c.737C>T
-16.7 Percentage of Participants
Interval -56.4 to 28.9
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
TERT c.215G>A
16.7 Percentage of Participants
Interval -28.9 to 56.4
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
TGFBR2 c.530-4T>A
0.0 Percentage of Participants
Interval -39.0 to 39.0
0.0 Percentage of Participants
Interval -39.0 to 39.0
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
TP53 c.215C>G
0.0 Percentage of Participants
Interval -39.0 to 39.0
0.0 Percentage of Participants
Interval -39.0 to 39.0
0.0 Percentage of Participants
Interval -56.1 to 56.1
0.0 Percentage of Participants
Interval -65.8 to 65.8
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
TP53 c.388delC
0.0 Percentage of Participants
Interval -39.0 to 39.0
0.0 Percentage of Participants
Interval -56.1 to 56.1
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
TP53 c.782+1G>A
0.0 Percentage of Participants
Interval -39.0 to 39.0
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
TUSC3 c.99_101delGCT
-16.7 Percentage of Participants
Interval -56.4 to 28.9
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
ZFHX3 c.10931G>T
-16.7 Percentage of Participants
Interval -56.4 to 28.9
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
ZFHX3 c.1135C>G
16.7 Percentage of Participants
Interval -28.9 to 56.4
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
ZFHX3 c.1631C>T
-16.7 Percentage of Participants
Interval -56.4 to 28.9
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
ZFHX3 c.2833T>G
-16.7 Percentage of Participants
Interval -56.4 to 28.9
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
ALK c.1043C>A
16.7 Percentage of Participants
Interval -28.9 to 56.4
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
APLNR c.349G>A
0.0 Percentage of Participants
Interval -39.0 to 39.0
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
CARD11 c.988G>A
0.0 Percentage of Participants
Interval -39.0 to 39.0
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
CHD4 c.4060G>C
-16.7 Percentage of Participants
Interval -56.4 to 28.9
0.0 Percentage of Participants
Interval -65.8 to 65.8
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
EGFR c.1008G>A
0.0 Percentage of Participants
Interval -39.0 to 39.0
0.0 Percentage of Participants
Interval -65.8 to 65.8
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
EP300 c.6613A>C
-16.7 Percentage of Participants
Interval -56.4 to 28.9
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
ERCC6 c.3661C>T
-16.7 Percentage of Participants
Interval -56.4 to 28.9
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
EZH2 c.848C>T
0.0 Percentage of Participants
Interval -39.0 to 39.0
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
FBXO11 c.164_169delAGCAGC
16.7 Percentage of Participants
Interval -28.9 to 56.4
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
FLT4 c.2405G>T
-16.7 Percentage of Participants
Interval -56.4 to 28.9
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
FOXO1 c.302C>T
16.7 Percentage of Participants
Interval -28.9 to 56.4
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
GNAQ c.303C>A
-16.7 Percentage of Participants
Interval -56.4 to 28.9
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
HOTS c.233_236delTACTinsCACC
16.7 Percentage of Participants
Interval -28.9 to 56.4
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
IRS2 c.1242C>A
-16.7 Percentage of Participants
Interval -56.4 to 28.9
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
KDM5C c.3019C>T
-16.7 Percentage of Participants
Interval -56.4 to 28.9
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
KIT c.597delA
-16.7 Percentage of Participants
Interval -56.4 to 28.9
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
KMT2A c.9400C>T
16.7 Percentage of Participants
Interval -28.9 to 56.4
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
KMT2B c.26G>A
-16.7 Percentage of Participants
Interval -56.4 to 28.9
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
KMT2C c.4845G>A
16.7 Percentage of Participants
Interval -28.9 to 56.4
50.0 Percentage of Participants
Interval -48.6 to 90.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
LRP1B c.4439G>A
0.0 Percentage of Participants
Interval -39.0 to 39.0
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
MAGEA10 c.1021G>T
-16.7 Percentage of Participants
Interval -56.4 to 28.9
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
MAP3K1 c.4292A>T
0.0 Percentage of Participants
Interval -39.0 to 39.0
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
MET c.2318C>T
0.0 Percentage of Participants
Interval -39.0 to 39.0
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
MSH6 c.1186C>G
0.0 Percentage of Participants
Interval -39.0 to 39.0
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
MSH6 c.1486T>G
0.0 Percentage of Participants
Interval -39.0 to 39.0
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
MUTYH c.64G>A
0.0 Percentage of Participants
Interval -39.0 to 39.0
0.0 Percentage of Participants
Interval -65.8 to 65.8
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
MYH11 c.5819dupC
16.7 Percentage of Participants
Interval -28.9 to 56.4
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
NF1 c.1082G>C
0.0 Percentage of Participants
Interval -39.0 to 39.0
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
NOTCH2 c.17_18delCC
-16.7 Percentage of Participants
Interval -56.4 to 28.9
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
NTRK3 c.137G>C
16.7 Percentage of Participants
Interval -28.9 to 56.4
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
PALB2 c.2993G>A
0.0 Percentage of Participants
Interval -39.0 to 39.0
0.0 Percentage of Participants
Interval -65.8 to 65.8
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
PALLD c.270_275dupCCCGCC
-16.7 Percentage of Participants
Interval -56.4 to 28.9
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
PAX8 c.352G>A
-16.7 Percentage of Participants
Interval -56.4 to 28.9
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
PDGFRB c.1543G>C
-16.7 Percentage of Participants
Interval -56.4 to 28.9
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
PIK3R1 c.1690A>G
16.7 Percentage of Participants
Interval -28.9 to 56.4
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
PIK3R1 c.935delC
-16.7 Percentage of Participants
Interval -56.4 to 28.9
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
PIK3R2 c.2047T>G
16.7 Percentage of Participants
Interval -28.9 to 56.4
0.0 Percentage of Participants
Interval -65.8 to 65.8
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
PLCG1 c.1825C>T
16.7 Percentage of Participants
Interval -28.9 to 56.4
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
PLCG2 c.2114G>A
0.0 Percentage of Participants
Interval -39.0 to 39.0
0.0 Percentage of Participants
Interval -65.8 to 65.8
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
PMS2 c.1789A>T
0.0 Percentage of Participants
Interval -39.0 to 39.0
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
PMS2 c.706-4delT
16.7 Percentage of Participants
Interval -28.9 to 56.4
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
PTPRD c.2069A>G
0.0 Percentage of Participants
Interval -39.0 to 39.0
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
RB1 c.1466G>A
16.7 Percentage of Participants
Interval -28.9 to 56.4
50.0 Percentage of Participants
Interval -48.6 to 90.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
RNF139 c.135C>G
-16.7 Percentage of Participants
Interval -56.4 to 28.9
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
ROS1 c.3416A>G
16.7 Percentage of Participants
Interval -28.9 to 56.4
50.0 Percentage of Participants
Interval -48.6 to 90.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
SYNE1 c.25403G>A
0.0 Percentage of Participants
Interval -39.0 to 39.0
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
TCF3 c.1643G>A
-16.7 Percentage of Participants
Interval -56.4 to 28.9
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
TEP1 c.3649C>T
0.0 Percentage of Participants
Interval -39.0 to 39.0
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
TP53 c.993G>T
-16.7 Percentage of Participants
Interval -56.4 to 28.9
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
TP53 c.994-2A>G
16.7 Percentage of Participants
Interval -28.9 to 56.4
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
U2AF1 c.101C>T
-16.7 Percentage of Participants
Interval -56.4 to 28.9
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
ZFHX3 c.11065A>G
16.7 Percentage of Participants
Interval -28.9 to 56.4
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
AATK c.65C>T
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
ABCC9 c.4535C>T
0.0 Percentage of Participants
Interval -56.1 to 56.1
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
ACADS c.989G>A
33.3 Percentage of Participants
Interval -41.5 to 79.2
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
ACAP3 c.1990C>T
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
ACSL4 c.106G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
ADAMTS13 c.3287G>A
33.3 Percentage of Participants
Interval -41.5 to 79.2
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
ADCY5 c.778C>T
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
ADGRE2 c.934C>A
33.3 Percentage of Participants
Interval -41.5 to 79.2
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
ADGRE3 c.1411G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
ADGRF2 c.680C>T
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
ADGRG3 c.1394C>T
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
ADH4 c.1174delA
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
AEBP1 c.799G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
AGFG2 c.340C>A
33.3 Percentage of Participants
Interval -41.5 to 79.2
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
AGPAT4 c.853C>T
0.0 Percentage of Participants
Interval -56.1 to 56.1
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
AGRN c.184C>A
33.3 Percentage of Participants
Interval -41.5 to 79.2
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
AGRN c.3157G>C
0.0 Percentage of Participants
Interval -56.1 to 56.1
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
AHNAK2 c.13479G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
AHNAK2 c.9650T>C
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
AKNA c.3907T>C
33.3 Percentage of Participants
Interval -41.5 to 79.2
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
ALS2CL c.14A>G
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
ANKRD61 c.323C>G
33.3 Percentage of Participants
Interval -41.5 to 79.2
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
ANKS1A c.157_159delGGC
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
ANKS1B c.2548C>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
ANTXR1 c.1121A>C
33.3 Percentage of Participants
Interval -41.5 to 79.2
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
ANTXR2 c.940G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
APC2 c.1312C>T
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
DALRD3 c.896A>G
33.3 Percentage of Participants
Interval -41.5 to 79.2
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
DDIAS c.2524G>A
33.3 Percentage of Participants
Interval -41.5 to 79.2
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
DEF8 c.1414G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
DEFB121 c.154G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
DENND1A c.1343G>T
0.0 Percentage of Participants
Interval -56.1 to 56.1
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
DENND2C c.794G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
DENND4A c.311G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
DFFB c.379G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
DGAT1 c.458G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
DGKI c.40C>T
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
DHRSX c.721G>A
33.3 Percentage of Participants
Interval -41.5 to 79.2
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
DNAH10 c.3640G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
DNAH9 c.1243C>A
33.3 Percentage of Participants
Interval -41.5 to 79.2
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
DOCK1 c.5259G>A
33.3 Percentage of Participants
Interval -41.5 to 79.2
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
DOCK11 c.307G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
DOCK2 c.543C>G
0.0 Percentage of Participants
Interval -56.1 to 56.1
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
DOCK3 c.2086G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
DOCK4 c.5740G>A
33.3 Percentage of Participants
Interval -41.5 to 79.2
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
DOCK8 c.1205C>T
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
DRAM2 c.133G>T
33.3 Percentage of Participants
Interval -41.5 to 79.2
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
EBPL c.20T>C
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
ARF6 c.352_354delCTC
33.3 Percentage of Participants
Interval -41.5 to 79.2
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
ARHGAP6 c.1585G>C
33.3 Percentage of Participants
Interval -41.5 to 79.2
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
ECT2 c.619C>T
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
EFHC2 c.679G>C
0.0 Percentage of Participants
Interval -56.1 to 56.1
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
EFHD1 c.88G>T
33.3 Percentage of Participants
Interval -41.5 to 79.2
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
ELMSAN1 c.939dupC
33.3 Percentage of Participants
Interval -41.5 to 79.2
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
ELOA2 c.1207G>T
33.3 Percentage of Participants
Interval -41.5 to 79.2
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
ENC1 c.206G>A
0.0 Percentage of Participants
Interval -56.1 to 56.1
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
ENDOG c.142G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
ESX1 c.959_985delCTGTGCCACCCGGGCCGCCCATGGCGC
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
EVC c.1168C>A
33.3 Percentage of Participants
Interval -41.5 to 79.2
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
FAM212A c.216_218delGGA
33.3 Percentage of Participants
Interval -41.5 to 79.2
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
FAM219A c.499G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
FAM220A c.266C>T
33.3 Percentage of Participants
Interval -41.5 to 79.2
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
FAM50B c.307C>T
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
FAM86B2 c.892+5A>G
33.3 Percentage of Participants
Interval -41.5 to 79.2
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
FAM89A c.110C>T
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
ARRDC4 c.227C>T
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
ARSI c.312G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
ASCC3 c.5962A>G
0.0 Percentage of Participants
Interval -56.1 to 56.1
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
FBXO3 c.7G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
ASH1L c.8522G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
ASPRV1 c.985G>T
33.3 Percentage of Participants
Interval -41.5 to 79.2
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
ATM c.3403-4dupT
0.0 Percentage of Participants
Interval -56.1 to 56.1
0.0 Percentage of Participants
Interval -65.8 to 65.8
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
FCF1 c.589C>T
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
FDX1L c.494C>T
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
FIGNL2 c.856G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
FIP1L1 c.1180C>T
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
FOXO4 c.574C>T
0.0 Percentage of Participants
Interval -56.1 to 56.1
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
ATP13A2 c.2984C>T
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
ATP2C2 c.2192delA
33.3 Percentage of Participants
Interval -41.5 to 79.2
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
ATP6AP1 c.508A>C
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
ATP7A c.3388C>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
FSCN2 c.853G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
ATRN c.263_268delCGGCGG
33.3 Percentage of Participants
Interval -41.5 to 79.2
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
B3GLCT c.517G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
B4GALNT2 c.1414G>A
33.3 Percentage of Participants
Interval -41.5 to 79.2
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
FUT7 c.49G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
B4GALT7 c.431T>C
33.3 Percentage of Participants
Interval -41.5 to 79.2
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
GAREM1 c.1673G>A
0.0 Percentage of Participants
Interval -56.1 to 56.1
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
BEGAIN c.1231G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
GGCT c.206C>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
BEST1 c.273C>G
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
BET1 c.327dupT
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
BNC1 c.86G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
GGT5 c.1334C>T
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
BOC c.896G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
BPIFB4 c.1146G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
BRPF1 c.3069C>T
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
BRPF1 c.823G>C
0.0 Percentage of Participants
Interval -56.1 to 56.1
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
GOLIM4 c.949C>T
33.3 Percentage of Participants
Interval -41.5 to 79.2
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
BRWD3 c.3188G>T
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
GP9 c.131C>T
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
BTBD17 c.106G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
C10orf88 c.401dupA
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
GPC1 c.1030G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
GPR149 c.1041C>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
GPR155 c.1384G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
C16orf95 c.407G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
C17orf100 c.71C>T
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
C17orf105 c.97G>A
33.3 Percentage of Participants
Interval -41.5 to 79.2
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
GPR52 c.18G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
C1QL4 c.185G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
GPR6 c.715C>T
33.3 Percentage of Participants
Interval -41.5 to 79.2
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
GRIA1 c.2318C>T
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
C1orf122 c.17G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
C1orf168 c.2134G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
C3 c.3566_3567delTG
33.3 Percentage of Participants
Interval -41.5 to 79.2
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
GUCY2D c.2035G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
CACNA1C c.169G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
CACNA1D c.58C>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
CACNA1I c.2939G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
HYAL3 c.428G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
IL6ST c.1165G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
ILF3 c.1480G>A
33.3 Percentage of Participants
Interval -41.5 to 79.2
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
CACNA1S c.4718C>T
0.0 Percentage of Participants
Interval -56.1 to 56.1
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
ING1 c.361C>T
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
IQCH c.310C>T
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
IQSEC3 c.1468G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
ISM2 c.701C>T
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
ITGA1 c.3334G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
ITGA9 c.1040C>T
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
ITGA9 c.433C>T
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
CADPS c.1595G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
CAPS2 c.158C>T
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
CARS2 c.1419C>T
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
CATSPERE c.2471A>C
0.0 Percentage of Participants
Interval -56.1 to 56.1
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
KATNA1 c.443G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
CC2D1A c.1030C>T
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
CC2D2B c.312G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
KCNAB3 c.689G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
KCNE5 c.370C>T
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
CCDC105 c.895G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
CCDC114 c.445G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
KCNN4 c.264G>T
33.3 Percentage of Participants
Interval -41.5 to 79.2
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
KCNQ4 c.2041G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
KDM2A c.1939G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
CCDC142 c.1220G>A
0.0 Percentage of Participants
Interval -56.1 to 56.1
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
KIF13A c.517C>T
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
CCDC168 c.17281G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
KIF13B c.5231G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
CCDC22 c.442C>T
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
KIF17 c.1204G>A
33.3 Percentage of Participants
Interval -41.5 to 79.2
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
KIF19 c.92C>T
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
CCDC39 c.1189C>G
33.3 Percentage of Participants
Interval -41.5 to 79.2
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
KIF1B c.2119A>G
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
CCDC70 c.239G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
CCDC73 c.896C>T
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
KRTAP17-1 c.125G>A
33.3 Percentage of Participants
Interval -41.5 to 79.2
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
KRTAP17-1 c.140G>A
33.3 Percentage of Participants
Interval -41.5 to 79.2
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
KSR1 c.254C>T
33.3 Percentage of Participants
Interval -41.5 to 79.2
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
CCDC8 c.316G>A
0.0 Percentage of Participants
Interval -56.1 to 56.1
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
CCDC91 c.1163C>T
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
CCP110 c.2504G>T
33.3 Percentage of Participants
Interval -41.5 to 79.2
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
LAMA5 c.7771C>G
0.0 Percentage of Participants
Interval -56.1 to 56.1
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
LAMB2 c.2089C>T
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
LCE3D c.221G>A
33.3 Percentage of Participants
Interval -41.5 to 79.2
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
LDOC1 c.417C>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
CD3G c.497G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
CD80 c.832G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
LIPN c.748A>G
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
LKAAEAR1 c.182G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
LMNA c.1634G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
CD9 c.85C>T
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
CDC25A c.1517G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
LOC729159 c.1004_1005delTGinsCA
33.3 Percentage of Participants
Interval -41.5 to 79.2
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
LRRC59 c.510G>C
0.0 Percentage of Participants
Interval -56.1 to 56.1
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
LRRN4 c.421A>G
33.3 Percentage of Participants
Interval -41.5 to 79.2
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
LRRN4 c.442C>T
33.3 Percentage of Participants
Interval -41.5 to 79.2
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
LYST c.7192G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
LZTR1 c.1892G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
MAD2L2 c.76G>T
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
CDH13 c.1498G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
CDH23 c.691G>C
33.3 Percentage of Participants
Interval -41.5 to 79.2
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
CDK18 c.1073G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
CDKN2A c.23G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
MAGEL2 c.2626G>A
0.0 Percentage of Participants
Interval -56.1 to 56.1
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
MAN2A1 c.1916dupA
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
MANEA c.1096C>T
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
MAP7D1 c.2182A>G
33.3 Percentage of Participants
Interval -41.5 to 79.2
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
MARCH1 c.11G>T
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
MIB2 c.208C>T
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
MIER2 c.1453A>G
33.3 Percentage of Participants
Interval -41.5 to 79.2
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
MIPEP c.1678C>T
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
CDX4 c.455G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
CEBPZ c.2155T>A
0.0 Percentage of Participants
Interval -56.1 to 56.1
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
MOV10L1 c.2459A>G
33.3 Percentage of Participants
Interval -41.5 to 79.2
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
CELSR3 c.5802delC
33.3 Percentage of Participants
Interval -41.5 to 79.2
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
MRE11 c.1532delA
33.3 Percentage of Participants
Interval -41.5 to 79.2
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
CELSR3 c.9748C>T
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
MRGPRE c.47G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
MRGPRX4 c.69C>G
0.0 Percentage of Participants
Interval -56.1 to 56.1
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
CENPE c.2797G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
MROH8 c.598G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
CENPE c.4270C>T
0.0 Percentage of Participants
Interval -56.1 to 56.1
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
CENPV c.596C>T
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
CEP170B c.1955T>C
33.3 Percentage of Participants
Interval -41.5 to 79.2
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
CEP170B c.3520C>G
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
CEP250 c.589G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
CFAP157 c.1441C>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
CFHR4 c.996C>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
CGB3 c.427G>T
33.3 Percentage of Participants
Interval -41.5 to 79.2
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
CHADL c.868C>A
33.3 Percentage of Participants
Interval -41.5 to 79.2
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
CHCHD10 c.227G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
CHD2 c.2366G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
CHD3 c.1796G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
CHD3 c.3880G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
CHPF c.2009A>T
0.0 Percentage of Participants
Interval -56.1 to 56.1
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
CHRNA5 c.1192G>A
33.3 Percentage of Participants
Interval -41.5 to 79.2
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
CHST13 c.716G>A
33.3 Percentage of Participants
Interval -41.5 to 79.2
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
CIZ1 c.626G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
CLCN6 c.698G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
CLCNKA c.476G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
CLDN15 c.301C>T
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
CLEC3A c.547G>T
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
CLEC4F c.839G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
NBPF8 c.1714C>G
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
NEO1 c.3193G>T
33.3 Percentage of Participants
Interval -41.5 to 79.2
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
CLIP4 c.890G>C
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
CLSPN c.533G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
CLTA c.698G>A
33.3 Percentage of Participants
Interval -41.5 to 79.2
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
CLUH c.2743G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
CMBL c.460G>A
0.0 Percentage of Participants
Interval -56.1 to 56.1
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
CNR1 c.982C>T
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
CNTD2 c.164C>T
0.0 Percentage of Participants
Interval -56.1 to 56.1
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
COL11A2 c.3100C>T
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
COL1A1 c.3680G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
COL22A1 c.3584G>T
33.3 Percentage of Participants
Interval -41.5 to 79.2
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
COL22A1 c.379C>T
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
COL27A1 c.2295C>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
COL4A1 c.3263G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
COL6A2 c.1267C>T
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
COL6A5 c.5543G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
CRB2 c.2873G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
CREB3L1 c.1267C>T
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
NPTX2 c.979C>T
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
NTRK2 c.2272G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
CRH c.445G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
CRYBG2 c.1418_1419insGTCCCCCACCTGGAAAGAGGTCGTGAAGGGCCCTGGTGCTCCTGCTGCCTC
33.3 Percentage of Participants
Interval -41.5 to 79.2
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
NUDT16 c.5C>T
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
CSMD1 c.1090G>A
0.0 Percentage of Participants
Interval -56.1 to 56.1
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
NUDT7 c.259G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
NUDT9 c.480delG
33.3 Percentage of Participants
Interval -41.5 to 79.2
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
NUFIP1 c.1336G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
ONECUT2 c.751C>T
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
OPRM1 c.266C>T
0.0 Percentage of Participants
Interval -56.1 to 56.1
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
PODXL2 c.1230delG
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
PARS2 c.599G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
PCDH9 c.923C>T
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
PCDHAC2 c.389C>T
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
PHACTR2 c.1429G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
PHF8 c.2385C>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
PHLDB1 c.3146G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
PHOX2B c.811C>G
33.3 Percentage of Participants
Interval -41.5 to 79.2
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
PLK5 c.505C>T
0.0 Percentage of Participants
Interval -56.1 to 56.1
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
PLXNB1 c.4699G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
RALGAPA2 c.1332G>T
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
SLC44A3 c.332A>T
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
CEP128 c.3073G>T
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
C16orf86 c.922C>T
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
C3 c.641C>A
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
CACFD1 c.665_668delCCCT
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
CAMKK2 c.1599_1601delGACinsAACAAAA
50.0 Percentage of Participants
Interval -48.6 to 90.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
CAPN13 c.1888A>G
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
CASKIN2 c.3538A>G
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
CASQ2 c.51C>A
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
CCDC106 c.138G>T
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
CCDC144A c.1001C>A
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
CEP290 c.5517G>T
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
CFAP36 c.685G>A
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
CFAP53 c.984_988delGAAACinsAAAAA
50.0 Percentage of Participants
Interval -48.6 to 90.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
CFAP65 c.2247G>A
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
CCNI2 c.460G>A
0.0 Percentage of Participants
Interval -65.8 to 65.8
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
CCT3 c.591delA
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
CD1B c.418G>T
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
CD7 c.44C>G
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
CGB3 c.16-2A>T
50.0 Percentage of Participants
Interval -48.6 to 90.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
CHEK2 c.1409A>G
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
CLCN3 c.1469G>A
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
CLDN19 c.503G>A
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
TET1 c.5408G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
TFRC c.1763G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
TTPA c.103G>A
33.3 Percentage of Participants
Interval -41.5 to 79.2
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
WDR18 c.1075C>A
33.3 Percentage of Participants
Interval -41.5 to 79.2
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
ZNF431 c.1462G>A
-33.3 Percentage of Participants
Interval -79.2 to 41.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
CLPTM1L c.1295T>A
0.0 Percentage of Participants
Interval -65.8 to 65.8
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
COL19A1 c.1703G>A
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
CRYBG3 c.4646C>A
0.0 Percentage of Participants
Interval -65.8 to 65.8
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
CXCL6 c.86C>T
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
CXorf36 c.587G>A
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
DEPDC1B c.682G>A
0.0 Percentage of Participants
Interval -65.8 to 65.8
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
GDF7 c.955C>T
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
GFRA1 c.665C>T
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
GGT1 c.1081G>C
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
GHR c.1705C>A
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
GIPR c.301C>T
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
GKAP1 c.427G>A
50.0 Percentage of Participants
Interval -48.6 to 90.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
GKAP1 c.432C>A
50.0 Percentage of Participants
Interval -48.6 to 90.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
GLP1R c.16G>T
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
GLYATL2 c.680A>C
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
GLYATL2 c.705A>C
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
GLYR1 c.1120G>A
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
GMNN c.161G>A
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
GNRH2 c.40_42delCTG
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
GOLGA8A c.1463C>T
50.0 Percentage of Participants
Interval -48.6 to 90.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
CDH17 c.1315G>A
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
CDK6 c.631G>A
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
DLG5 c.2296G>T
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
DNAAF3 c.976G>A
0.0 Percentage of Participants
Interval -65.8 to 65.8
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
DNAH9 c.6762G>T
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
DOLPP1 c.500A>T
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
EML5 c.824G>A
0.0 Percentage of Participants
Interval -65.8 to 65.8
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
ENAM c.869G>A
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
ENO4 c.1751A>T
50.0 Percentage of Participants
Interval -48.6 to 90.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
ENPEP c.1552G>T
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
EOGT c.419C>T
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
ESRP2 c.381G>A
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
EXOSC10 c.1751C>T
50.0 Percentage of Participants
Interval -48.6 to 90.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
F2RL1 c.280G>A
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
FAM186A c.4757_4828delAACTGGGGATCCCTCTCACCCCTCAGC AGGCGCAGGAACTGGGGATCCCTCTCACCCCTCAGCAGGC GCAGG
50.0 Percentage of Participants
Interval -48.6 to 90.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
FAM193A c.1769C>T
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
FAM90A1 c.1261G>T
50.0 Percentage of Participants
Interval -48.6 to 90.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
FAM9B c.285G>T
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
FANCI c.153C>A
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
FARSB c.1177C>T
50.0 Percentage of Participants
Interval -48.6 to 90.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
FAT1 c.10630G>A
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
FBL c.407C>T
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
FGF10 c.365C>T
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
FIG4 c.2347G>A
50.0 Percentage of Participants
Interval -48.6 to 90.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
FNTA c.408C>A
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
FOXRED1 c.104C>T
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
FOXRED1 c.65G>A
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
HOXD13 c.120C>A
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
HRH1 c.1048C>A
50.0 Percentage of Participants
Interval -48.6 to 90.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
FXR2 c.994A>G
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
GAB3 c.1307C>A
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
HRNR c.7688G>C
50.0 Percentage of Participants
Interval -48.6 to 90.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
GAGE2A c.175C>G
50.0 Percentage of Participants
Interval -48.6 to 90.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
GALR2 c.646C>A
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
HSD17B12 c.682C>T
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
HSPG2 c.8873C>T
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
HUWE1 c.1553C>A
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
HUWE1 c.1924G>T
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
HUWE1 c.7633C>A
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
GOLGA8A c.1505G>A
50.0 Percentage of Participants
Interval -48.6 to 90.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
GOLGA8A c.1538G>A
0.0 Percentage of Participants
Interval -65.8 to 65.8
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
GRIK4 c.2590C>T
0.0 Percentage of Participants
Interval -65.8 to 65.8
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
GRM7 c.2014G>A
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
H2AFY c.10C>T
0.0 Percentage of Participants
Interval -65.8 to 65.8
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
LOC101928841 c.3272G>A
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
HAUS5 c.425C>T
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
HERC1 c.11036G>A
50.0 Percentage of Participants
Interval -48.6 to 90.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
HIF3A c.1573C>T
0.0 Percentage of Participants
Interval -65.8 to 65.8
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
HOXA13 c.396_398delCGC
50.0 Percentage of Participants
Interval -48.6 to 90.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
ICAM4 c.38dupT
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
IGFN1 c.5624C>G
0.0 Percentage of Participants
Interval -65.8 to 65.8
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
IL12RB1 c.1442G>A
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
ILF2 c.40_41delGGinsTT
0.0 Percentage of Participants
Interval -65.8 to 65.8
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
IQSEC3 c.973G>A
0.0 Percentage of Participants
Interval -65.8 to 65.8
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
ITGAD c.2240G>A
0.0 Percentage of Participants
Interval -65.8 to 65.8
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
ITPR2 c.8022G>T
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
JKAMP c.158G>C
0.0 Percentage of Participants
Interval -65.8 to 65.8
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
JPH3 c.169A>G
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
KIAA0513 c.646G>T
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
KIAA0895 c.720C>G
0.0 Percentage of Participants
Interval -65.8 to 65.8
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
MRPL21 c.581G>A
0.0 Percentage of Participants
Interval -65.8 to 65.8
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
MUC12 c.5251A>C
0.0 Percentage of Participants
Interval -65.8 to 65.8
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
MUC12 c.5575G>A
50.0 Percentage of Participants
Interval -48.6 to 90.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
MUC12 c.5612C>T
50.0 Percentage of Participants
Interval -48.6 to 90.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
KIAA1107 c.3152C>A
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
MUC16 c.17447G>A
0.0 Percentage of Participants
Interval -65.8 to 65.8
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
MUC19 c.3641G>A
0.0 Percentage of Participants
Interval -65.8 to 65.8
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
MUC4 c.3605T>C
50.0 Percentage of Participants
Interval -48.6 to 90.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
MUC4 c.7039A>T
50.0 Percentage of Participants
Interval -48.6 to 90.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
MUC4 c.8259_10034dup
50.0 Percentage of Participants
Interval -48.6 to 90.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
MVD c.665G>A
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
MX1 c.454G>A
50.0 Percentage of Participants
Interval -48.6 to 90.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
MYCBP2 c.1826C>T
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
MYCBP2 c.3572C>T
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
MYH14 c.2935G>A
0.0 Percentage of Participants
Interval -65.8 to 65.8
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
MYOF c.1772_1773delAG
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
MYOM3 c.221C>T
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
NALCN c.2063_2065delCCT
0.0 Percentage of Participants
Interval -65.8 to 65.8
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
NANOGNB c.495_501delGCATAAGinsAAAAAAA
50.0 Percentage of Participants
Interval -48.6 to 90.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
NBEA c.5218G>T
50.0 Percentage of Participants
Interval -48.6 to 90.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
NCKIPSD c.1430C>T
50.0 Percentage of Participants
Interval -48.6 to 90.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
NEB c.17635-2_17635delAGAinsTTT
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
NEK1 c.739C>T
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
NEPRO c.837delA
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
NEUROD6 c.89A>G
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
NFATC1 c.179C>T
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
NHS c.2203C>T
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
NLRP12 c.2971C>A
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
NLRP14 c.3228G>T
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
NLRP6 c.176C>T
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
NMD3 c.754G>T
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
NPHP3 c.1525-4_1526delCTAGTAinsTTTTTT
50.0 Percentage of Participants
Interval -48.6 to 90.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
NR2E1 c.592C>A
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
NRAP c.4058G>T
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
NRG2 c.2084G>A
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
KIAA1107 c.3310C>A
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
NUCB1 c.664C>T
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
NUP98 c.2972C>A
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
NYAP2 c.703G>A
0.0 Percentage of Participants
Interval -65.8 to 65.8
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
NYNRIN c.3662G>A
0.0 Percentage of Participants
Interval -65.8 to 65.8
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
OBSCN c.6543G>C
0.0 Percentage of Participants
Interval -65.8 to 65.8
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
KIF5C c.226G>T
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
OR13C5 c.243_244delGC
50.0 Percentage of Participants
Interval -48.6 to 90.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
OR2T2 c.612_618delCGTGCTG
0.0 Percentage of Participants
Interval -65.8 to 65.8
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
OR2T2 c.785T>A
50.0 Percentage of Participants
Interval -48.6 to 90.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
OR2T3 c.611T>C
50.0 Percentage of Participants
Interval -48.6 to 90.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
OR2T8 c.590T>G
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
OR2W3 c.337C>A
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
OR4C12 c.222_224delTTC
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
OR51A4 c.497_500delGAAAinsCAAG
50.0 Percentage of Participants
Interval -48.6 to 90.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
OR52D1 c.127G>T
50.0 Percentage of Participants
Interval -48.6 to 90.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
OSMR c.937G>T
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
OTOF c.5567G>A
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
PADI3 c.1739C>A
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
PCDH18 c.809C>T
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
PCDH8 c.1583G>A
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
PCLO c.2545G>A
0.0 Percentage of Participants
Interval -65.8 to 65.8
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
PGLYRP3 c.551G>T
0.0 Percentage of Participants
Interval -65.8 to 65.8
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
PGS1 c.1069A>G
0.0 Percentage of Participants
Interval -65.8 to 65.8
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
PIGO c.3116delT
0.0 Percentage of Participants
Interval -65.8 to 65.8
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
PKD1 c.2647C>A
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
PLD3 c.464C>T
0.0 Percentage of Participants
Interval -65.8 to 65.8
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
KLHL34 c.1513G>T
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
PLK2 c.328G>A
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
PLXNA1 c.1114C>T
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
PLXND1 c.1393G>A
50.0 Percentage of Participants
Interval -48.6 to 90.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
PML c.1753delC
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
POLQ c.6811C>A
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
POLR2B c.632delA
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
POM121 c.1916A>C
50.0 Percentage of Participants
Interval -48.6 to 90.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
POM121C c.1162_1169delTTTGACTCinsCT
0.0 Percentage of Participants
Interval -65.8 to 65.8
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
POTEB2 c.119C>A
50.0 Percentage of Participants
Interval -48.6 to 90.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
PPP1R12C c.1907C>G
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
PPP2R2B c.1196G>A
50.0 Percentage of Participants
Interval -48.6 to 90.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
PPWD1 c.197-6_198delCTTCAGTCinsTTTTTTTT
50.0 Percentage of Participants
Interval -48.6 to 90.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
PRAMEF2 c.280C>T
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
PRKDC c.2601C>A
50.0 Percentage of Participants
Interval -48.6 to 90.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
PROSER1 c.1587G>T
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
PRR19 c.355C>T
50.0 Percentage of Participants
Interval -48.6 to 90.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
PRRT3 c.543G>T
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
PRSS56 c.1646G>A
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
PTPN13 c.4093G>T
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
R3HDM2 c.79_80delAA
0.0 Percentage of Participants
Interval -65.8 to 65.8
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
RABGEF1 c.854C>T
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
RAD50 c.2165delA
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
RAP2B c.56T>G
0.0 Percentage of Participants
Interval -65.8 to 65.8
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
RASGEF1A c.1062delC
0.0 Percentage of Participants
Interval -65.8 to 65.8
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
RBM15 c.1231G>A
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
RBMX c.217-2_217-1delAGinsTT
50.0 Percentage of Participants
Interval -48.6 to 90.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
RD3 c.292C>T
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
RGPD1 c.4329A>C
50.0 Percentage of Participants
Interval -48.6 to 90.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
RGS17 c.55C>T
0.0 Percentage of Participants
Interval -65.8 to 65.8
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
RIMBP2 c.2627C>T
0.0 Percentage of Participants
Interval -65.8 to 65.8
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
RLBP1 c.307C>T
0.0 Percentage of Participants
Interval -65.8 to 65.8
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
RNF128 c.103G>A
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
RRN3 c.337A>G
50.0 Percentage of Participants
Interval -48.6 to 90.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
RSL1D1 c.1147-5_1147delCTTAGAinsTTTTTT
50.0 Percentage of Participants
Interval -48.6 to 90.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
KLHL9 c.825T>G
0.0 Percentage of Participants
Interval -65.8 to 65.8
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
RSPH3 c.1186G>A
0.0 Percentage of Participants
Interval -65.8 to 65.8
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
RTTN c.5365G>A
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
S100A7 c.139T>G
0.0 Percentage of Participants
Interval -65.8 to 65.8
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
SAMD13 c.169G>A
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
SCML2 c.654G>T
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
SCN1A c.1363C>A
0.0 Percentage of Participants
Interval -65.8 to 65.8
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
SCN7A c.2098G>A
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
SCRIB c.4063C>T
50.0 Percentage of Participants
Interval -48.6 to 90.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
SDK1 c.1769C>A
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
SDK2 c.4706C>A
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
SEC24A c.2346C>A
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
SEMA6D c.509C>T
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
SESN1 c.1469G>A
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
SFT2D3 c.314C>T
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
SHANK1 c.1329G>T
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
SHANK1 c.1366G>A
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
SHROOM2 c.2815C>A
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
SIX3 c.406_407delGC
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
SLC30A10 c.1408C>A
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
SPTBN5 c.2405G>A
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
SPTLC1 c.1110C>A
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
ST7 c.1658G>C
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
STARD9 c.1654C>T
50.0 Percentage of Participants
Interval -48.6 to 90.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
STK32A c.326G>A
0.0 Percentage of Participants
Interval -65.8 to 65.8
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
KLRK1 c.197G>A
50.0 Percentage of Participants
Interval -48.6 to 90.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
STRBP c.709C>T
0.0 Percentage of Participants
Interval -65.8 to 65.8
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
SVIL c.2083G>A
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
SYNE1 c.23551A>G
50.0 Percentage of Participants
Interval -48.6 to 90.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
SYNGR1 c.34G>A
50.0 Percentage of Participants
Interval -48.6 to 90.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
KNL1 c.1800G>T
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
KRT13 c.610G>A
0.0 Percentage of Participants
Interval -65.8 to 65.8
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
KRTAP9-9 c.35_36insACCTGCTGCAGGACC
50.0 Percentage of Participants
Interval -48.6 to 90.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
LCA5L c.1198G>A
50.0 Percentage of Participants
Interval -48.6 to 90.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
LCAT c.625C>A
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
LCT c.1925C>A
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
LDB3 c.2012G>A
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
LILRB5 c.1274C>T
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
TACC2 c.798G>T
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
TCF7L1 c.40_42delGGC
50.0 Percentage of Participants
Interval -48.6 to 90.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
TCTN2 c.127G>A
0.0 Percentage of Participants
Interval -65.8 to 65.8
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
TEX30 c.132_133delTC
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
TFCP2L1 c.161C>T
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
TM4SF1 c.199T>G
0.0 Percentage of Participants
Interval -65.8 to 65.8
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
TMEM202 c.603C>G
0.0 Percentage of Participants
Interval -65.8 to 65.8
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
SLU7 c.576delA
50.0 Percentage of Participants
Interval -48.6 to 90.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
SOAT1 c.1421T>G
50.0 Percentage of Participants
Interval -48.6 to 90.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
TMEM72 c.490G>A
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
TMOD3 c.151C>G
0.0 Percentage of Participants
Interval -65.8 to 65.8
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
LMNA c.1977G>T
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
TMPRSS6 c.435C>A
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
SKP1 c.21G>T
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
SLC25A12 c.887C>A
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
SLC2A11 c.995C>T
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
SLC35F2 c.448G>A
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
SLC38A2 c.549T>G
0.0 Percentage of Participants
Interval -65.8 to 65.8
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
SLC39A6 c.1088C>T
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
SLC5A2 c.236G>A
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
SLC7A14 c.1963T>C
0.0 Percentage of Participants
Interval -65.8 to 65.8
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
SOCS6 c.781G>A
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
SORBS1 c.3400G>A
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
SP140 c.205G>T
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
SLC7A9 c.887G>A
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
SPATA31E1 c.2651G>A
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
SPPL2B c.634G>T
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
TMPRSS6 c.943G>A
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
TNFAIP2 c.512_514delCGG
50.0 Percentage of Participants
Interval -48.6 to 90.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
TNXB c.8806G>A
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
TOGARAM2 c.2090C>A
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
TOP3B c.2299T>C
50.0 Percentage of Participants
Interval -48.6 to 90.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
TRIM17 c.232C>T
0.0 Percentage of Participants
Interval -65.8 to 65.8
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
TRIM28 c.335G>A
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
TRIM3 c.2235G>T
0.0 Percentage of Participants
Interval -65.8 to 65.8
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
TRIO c.9289G>C
0.0 Percentage of Participants
Interval -65.8 to 65.8
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
TRIP12 c.1099C>T
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
TSHZ1 c.1204G>A
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
TSPEAR c.59C>T
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
TSSC4 c.538G>T
0.0 Percentage of Participants
Interval -65.8 to 65.8
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
TVP23A c.271T>C
50.0 Percentage of Participants
Interval -48.6 to 90.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
UBD c.3G>A
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
UBE2O c.1813G>A
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
UGDH c.1294delA
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
UGGT2 c.3474-467_3480del
50.0 Percentage of Participants
Interval -48.6 to 90.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
URI1 c.49G>T
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
USP28 c.2845C>T
50.0 Percentage of Participants
Interval -48.6 to 90.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
UTF1 c.302C>T
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
VSTM2B c.457G>A
50.0 Percentage of Participants
Interval -48.6 to 90.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
VSTM2B c.603C>A
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
WASHC2C c.1562A>C
50.0 Percentage of Participants
Interval -48.6 to 90.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
WFS1 c.577_579delAAG
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
WISP1 c.580A>G
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
WWC1 c.2972T>G
0.0 Percentage of Participants
Interval -65.8 to 65.8
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
YBX3 c.40_42delACC
50.0 Percentage of Participants
Interval -48.6 to 90.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
ZFPM1 c.2596C>T
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
ZNF148 c.2380_2383delGGCTinsAA
50.0 Percentage of Participants
Interval -48.6 to 90.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
ZNF221 c.335C>T
50.0 Percentage of Participants
Interval -48.6 to 90.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
ZNF354C c.1060A>G
50.0 Percentage of Participants
Interval -48.6 to 90.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
ZNF366 c.1475T>G
0.0 Percentage of Participants
Interval -65.8 to 65.8
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
ZNF41 c.1700_1702delAAA
0.0 Percentage of Participants
Interval -65.8 to 65.8
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
ZNF521 c.3122T>C
0.0 Percentage of Participants
Interval -65.8 to 65.8
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
ZNF550 c.157C>A
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
ZNF552 c.524_525dupGG
50.0 Percentage of Participants
Interval -48.6 to 90.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
ZNF552 c.533T>G
50.0 Percentage of Participants
Interval -48.6 to 90.5
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
ZNF628 c.794C>A
-50.0 Percentage of Participants
Interval -90.5 to 48.6
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
ZNF883 c.664C>A
0.0 Percentage of Participants
Interval -65.8 to 65.8
Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies
ZSWIM6 c.82_84dupAGC
50.0 Percentage of Participants
Interval -48.6 to 90.5

SECONDARY outcome

Timeframe: Through study completion, approximately 3 months

Population: Participants included in the Safety Analysis population in 7 cohorts.

Estimating the number of fully biomarker evaluable population by cohort to evaluate the success rate in obtaining paired archival and post-progression tumor biopsies that were adequate to meet the objectives of the study

Outcome measures

Outcome measures
Measure
HR+ HER2- Adenocarcinoma of the Breast With NGS Results
n=1 Participants
Participants in Cohort 4 with progressive disease on 1st line combination of doublet palbociclib with hormonal therapy and with NGS results from pre-treatment and post-progression tumor samples available.
Castrate-resistant Adenocarcinoma of the Prostate With NGS Results
n=4 Participants
Participants in Cohort 5 \& 6 with progressive disease on enzalutamide monotherapy and on abiraterone in combination with prednisone and with NGS results from pre-treatment and post-progression tumor samples available.
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results
n=5 Participants
Participants in Cohort 4 with progressive disease on 1st line combination of doublet palbociclib with hormonal therapy and with whole exome sequencing NGS results from pre-treatment and post-progression tumor samples available.
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results
n=11 Participants
Participants in Cohort 5 \& 6 with progressive disease on enzalutamide monotherapy and on abiraterone in combination with prednisone and with whole exome sequencing NGS results from pre-treatment and post-progression tumor samples available.
Cohort 5: Castrate-resistant Adenocarcinoma of the Prostate
n=5 Participants
Progressive disease on enzalutamide monotherapy.
Cohort 6: Castrate-resistant Adenocarcinoma of the Prostate
n=11 Participants
Progressive disease on abiraterone in combination with prednisone.
Cohort 7: gBRCAm HER2- Adenocarcinoma of the Breast
n=1 Participants
Progressive disease on a PARP inhibitor monotherapy in participants previously treated with chemotherapy in the neoadjuvant, adjuvant, or metastatic setting.
Number of Participants With Fully Evaluable Archival and Post-Progression Tumor Biopsy by Cohort
Safety Analysis (SA)
1 Participants
4 Participants
5 Participants
10 Participants
5 Participants
10 Participants
1 Participants
Number of Participants With Fully Evaluable Archival and Post-Progression Tumor Biopsy by Cohort
Biomarker Evaluable (BE)
1 Participants
4 Participants
5 Participants
8 Participants
5 Participants
8 Participants
1 Participants
Number of Participants With Fully Evaluable Archival and Post-Progression Tumor Biopsy by Cohort
Biomarker Evaluable Target (BET)
0 Participants
1 Participants
3 Participants
6 Participants
4 Participants
2 Participants
1 Participants
Number of Participants With Fully Evaluable Archival and Post-Progression Tumor Biopsy by Cohort
Fully Biomarker Evaluable (FBE)
0 Participants
1 Participants
1 Participants
1 Participants
1 Participants
0 Participants
0 Participants

SECONDARY outcome

Timeframe: Through study completion, approximately 3 months

Population: Number of Participants Analyzed shows the number of participants with available results for the corresponding gene alterations. Data for this outcome measure was not collected for Cohorts 1,2, 3 and 7 due to early termination of the study by Sponsor. Data for Cohorts 5 and 6 was combined to report combined results for Cohorts 5 and 6, to meet the sample size was deemed sufficient to generate informative summary statistics, as pre-specified in the Study Protocol.

Genetic alterations detected in blood were compared to those detected in tissue. Only gene alterations with frequency of 5% or greater based on assessment of tumor biopsy were included in the analysis.

Outcome measures

Outcome measures
Measure
HR+ HER2- Adenocarcinoma of the Breast With NGS Results
n=8 Participants
Participants in Cohort 4 with progressive disease on 1st line combination of doublet palbociclib with hormonal therapy and with NGS results from pre-treatment and post-progression tumor samples available.
Castrate-resistant Adenocarcinoma of the Prostate With NGS Results
n=10 Participants
Participants in Cohort 5 \& 6 with progressive disease on enzalutamide monotherapy and on abiraterone in combination with prednisone and with NGS results from pre-treatment and post-progression tumor samples available.
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results
Participants in Cohort 4 with progressive disease on 1st line combination of doublet palbociclib with hormonal therapy and with whole exome sequencing NGS results from pre-treatment and post-progression tumor samples available.
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results
Participants in Cohort 5 \& 6 with progressive disease on enzalutamide monotherapy and on abiraterone in combination with prednisone and with whole exome sequencing NGS results from pre-treatment and post-progression tumor samples available.
Cohort 5: Castrate-resistant Adenocarcinoma of the Prostate
Progressive disease on enzalutamide monotherapy.
Cohort 6: Castrate-resistant Adenocarcinoma of the Prostate
Progressive disease on abiraterone in combination with prednisone.
Cohort 7: gBRCAm HER2- Adenocarcinoma of the Breast
Progressive disease on a PARP inhibitor monotherapy in participants previously treated with chemotherapy in the neoadjuvant, adjuvant, or metastatic setting.
Overall Agreement Rate of Gene Alterations Between Post-Progression Tumor Biopsy and Blood NGS Results
11.9 Percentage of agreed gene alterations
Interval 0.0 to 18.8
0.0 Percentage of agreed gene alterations
Interval 0.0 to 16.7

SECONDARY outcome

Timeframe: Through study completion, approximately 3 months

Population: The BET population was participants in the BE population who had a targeted tumor DNA panel biomarker result from both archival and de novo biopsy tumor tissue biospecimen. BET (WETD) was defined as all participants in the BET population who had results of WETD NGS sample analysis from both the archival and de novo biopsy tumor tissue biospecimen. RB1 Gene Alterations analysis was only conducted for Cohort 4 as per protocol.

Mutations in RB1 gene associated with immune function, have also been shown to impact tumor immunogenicity and related with CDK4/6 inhibition. CDK4 or CDK6 complexed with cyclin D1 (CCND1) phosphorylates the retinoblastoma gene product (Rb), releasing the E2F and DP transcription factors that regulate the expression of genes required for entry into the S phase of the cell cycle. Calculation of change in frequency was decribed in the primary endpoint (Outcome Measure 1).

Outcome measures

Outcome measures
Measure
HR+ HER2- Adenocarcinoma of the Breast With NGS Results
n=6 Participants
Participants in Cohort 4 with progressive disease on 1st line combination of doublet palbociclib with hormonal therapy and with NGS results from pre-treatment and post-progression tumor samples available.
Castrate-resistant Adenocarcinoma of the Prostate With NGS Results
n=3 Participants
Participants in Cohort 5 \& 6 with progressive disease on enzalutamide monotherapy and on abiraterone in combination with prednisone and with NGS results from pre-treatment and post-progression tumor samples available.
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results
Participants in Cohort 4 with progressive disease on 1st line combination of doublet palbociclib with hormonal therapy and with whole exome sequencing NGS results from pre-treatment and post-progression tumor samples available.
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results
Participants in Cohort 5 \& 6 with progressive disease on enzalutamide monotherapy and on abiraterone in combination with prednisone and with whole exome sequencing NGS results from pre-treatment and post-progression tumor samples available.
Cohort 5: Castrate-resistant Adenocarcinoma of the Prostate
Progressive disease on enzalutamide monotherapy.
Cohort 6: Castrate-resistant Adenocarcinoma of the Prostate
Progressive disease on abiraterone in combination with prednisone.
Cohort 7: gBRCAm HER2- Adenocarcinoma of the Breast
Progressive disease on a PARP inhibitor monotherapy in participants previously treated with chemotherapy in the neoadjuvant, adjuvant, or metastatic setting.
Change in Frequency of RB1 Gene Alterations Between Pre-Treatment Archival and Post-Progression Samples
0.0 Percentage of participants
Interval -39.0 to 39.0
-33.3 Percentage of participants
Interval -79.2 to 41.5

SECONDARY outcome

Timeframe: Through study completion, approximately 3 months

Population: BE (TBD) was analyzed and defined as all participants in the BE population who have results of targeted blood cfDNA (TBD) NGS gene panel sample analysis from the post-progression blood sample.

Mutations in RB1 gene associated with immune function, have also been shown to impact tumor immunogenicity and related with CDK4/6 inhibition. CDK4 or CDK6 complexed with cyclin D1 (CCND1) phosphorylates the retinoblastoma gene product (Rb), releasing the E2F and DP transcription factors that regulate the expression of genes required for entry into the S phase of the cell cycle. Percentage of Participants Who Carried the RB1 Gene Alterations in Post Progression Blood cfDNA analysis was only conducted for Cohort 4 as per protocol.

Outcome measures

Outcome measures
Measure
HR+ HER2- Adenocarcinoma of the Breast With NGS Results
n=8 Participants
Participants in Cohort 4 with progressive disease on 1st line combination of doublet palbociclib with hormonal therapy and with NGS results from pre-treatment and post-progression tumor samples available.
Castrate-resistant Adenocarcinoma of the Prostate With NGS Results
Participants in Cohort 5 \& 6 with progressive disease on enzalutamide monotherapy and on abiraterone in combination with prednisone and with NGS results from pre-treatment and post-progression tumor samples available.
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results
Participants in Cohort 4 with progressive disease on 1st line combination of doublet palbociclib with hormonal therapy and with whole exome sequencing NGS results from pre-treatment and post-progression tumor samples available.
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results
Participants in Cohort 5 \& 6 with progressive disease on enzalutamide monotherapy and on abiraterone in combination with prednisone and with whole exome sequencing NGS results from pre-treatment and post-progression tumor samples available.
Cohort 5: Castrate-resistant Adenocarcinoma of the Prostate
Progressive disease on enzalutamide monotherapy.
Cohort 6: Castrate-resistant Adenocarcinoma of the Prostate
Progressive disease on abiraterone in combination with prednisone.
Cohort 7: gBRCAm HER2- Adenocarcinoma of the Breast
Progressive disease on a PARP inhibitor monotherapy in participants previously treated with chemotherapy in the neoadjuvant, adjuvant, or metastatic setting.
Percentage of Participants Who Carried the RB1 Gene Alterations in Post-Progression Blood cfDNA
c.151G>T
12.5 Percentage of participants
Interval 2.2 to 47.1
Percentage of Participants Who Carried the RB1 Gene Alterations in Post-Progression Blood cfDNA
c.184C>T
12.5 Percentage of participants
Interval 2.2 to 47.1
Percentage of Participants Who Carried the RB1 Gene Alterations in Post-Progression Blood cfDNA
c.54_79delGGAACCCCCGGCACCGCCGCCGCCGC
12.5 Percentage of participants
Interval 2.2 to 47.1

SECONDARY outcome

Timeframe: Through study completion, approximately 3 months

Population: The BET and BET (WETD) population was participants in the BE population who have a targeted tumor DNA panel biomarker result, and all participants in the BET population who have results of WETD NGS sample analysis, from both the archival and de novo biopsy tumor tissue biospecimen, respectively. One participant in Cohort 6 was included in the BET analysis population given the small number of eligible samples and the fact that participant's bone sample met analytical requirements.

Pre-treatment archival tumor samples and post-progression de novo tumor biopsies were analyzed to identify molecular markers of resistance to selected anti-cancer therapies. Calculation of change in frequency was described for in the primary endpoint (Outcome Measure 1). AR gene Alterations analysis was only conducted for the Cohorts 5 \& 6 as per protocol.

Outcome measures

Outcome measures
Measure
HR+ HER2- Adenocarcinoma of the Breast With NGS Results
n=6 Participants
Participants in Cohort 4 with progressive disease on 1st line combination of doublet palbociclib with hormonal therapy and with NGS results from pre-treatment and post-progression tumor samples available.
Castrate-resistant Adenocarcinoma of the Prostate With NGS Results
n=2 Participants
Participants in Cohort 5 \& 6 with progressive disease on enzalutamide monotherapy and on abiraterone in combination with prednisone and with NGS results from pre-treatment and post-progression tumor samples available.
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results
Participants in Cohort 4 with progressive disease on 1st line combination of doublet palbociclib with hormonal therapy and with whole exome sequencing NGS results from pre-treatment and post-progression tumor samples available.
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results
Participants in Cohort 5 \& 6 with progressive disease on enzalutamide monotherapy and on abiraterone in combination with prednisone and with whole exome sequencing NGS results from pre-treatment and post-progression tumor samples available.
Cohort 5: Castrate-resistant Adenocarcinoma of the Prostate
Progressive disease on enzalutamide monotherapy.
Cohort 6: Castrate-resistant Adenocarcinoma of the Prostate
Progressive disease on abiraterone in combination with prednisone.
Cohort 7: gBRCAm HER2- Adenocarcinoma of the Breast
Progressive disease on a PARP inhibitor monotherapy in participants previously treated with chemotherapy in the neoadjuvant, adjuvant, or metastatic setting.
Change in Frequency of AR Gene Alterations Between Pre-Treatment Archival and Post-Progression Samples
0.0 percentage of participants
Interval -39.0 to 39.0
0.0 percentage of participants
Interval -65.8 to 65.8

SECONDARY outcome

Timeframe: Through study completion, approximately 3 months

Population: BE (TBD) was analyzed and defined as all participants in the BE population who have results of targeted blood cfDNA (TBD) NGS gene panel sample analysis from the post-progression blood sample.

Androgen receptor (AR) gene alterations can be evaluated as mechanisms of resistance to enzalutamide or abiraterone. Percentage of Participants Who Carried the AR Gene Alterations in Post-Progression Blood cfDNA analysis was conducted as it was only applicable to Cohorts 5 \&6.

Outcome measures

Outcome measures
Measure
HR+ HER2- Adenocarcinoma of the Breast With NGS Results
n=10 Participants
Participants in Cohort 4 with progressive disease on 1st line combination of doublet palbociclib with hormonal therapy and with NGS results from pre-treatment and post-progression tumor samples available.
Castrate-resistant Adenocarcinoma of the Prostate With NGS Results
Participants in Cohort 5 \& 6 with progressive disease on enzalutamide monotherapy and on abiraterone in combination with prednisone and with NGS results from pre-treatment and post-progression tumor samples available.
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results
Participants in Cohort 4 with progressive disease on 1st line combination of doublet palbociclib with hormonal therapy and with whole exome sequencing NGS results from pre-treatment and post-progression tumor samples available.
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results
Participants in Cohort 5 \& 6 with progressive disease on enzalutamide monotherapy and on abiraterone in combination with prednisone and with whole exome sequencing NGS results from pre-treatment and post-progression tumor samples available.
Cohort 5: Castrate-resistant Adenocarcinoma of the Prostate
Progressive disease on enzalutamide monotherapy.
Cohort 6: Castrate-resistant Adenocarcinoma of the Prostate
Progressive disease on abiraterone in combination with prednisone.
Cohort 7: gBRCAm HER2- Adenocarcinoma of the Breast
Progressive disease on a PARP inhibitor monotherapy in participants previously treated with chemotherapy in the neoadjuvant, adjuvant, or metastatic setting.
Percentage of Participants Who Carried the AR Gene Alterations in Post-Progression Blood cfDNA
c.2105T>A
20.0 Percentage of participants
Interval 5.7 to 51.0
Percentage of Participants Who Carried the AR Gene Alterations in Post-Progression Blood cfDNA
c.2202G>C
10.0 Percentage of participants
Interval 1.8 to 40.4
Percentage of Participants Who Carried the AR Gene Alterations in Post-Progression Blood cfDNA
c.2632A>G
10.0 Percentage of participants
Interval 1.8 to 40.4

SECONDARY outcome

Timeframe: Through study completion, approximately 3 months

Population: BET (TTR) and BET (WTTR) population was all participants in the BET population who have results of TTR sample analysis, and all participants in the BET population who have results of WTTR NGS sample analysis, from both the archival and de novo biopsy tumor tissue biospecimen, respectively. One participant in Cohort 6 was included in the BET analysis population given the small number of eligible samples and the fact that participant's bone sample met analytical requirements.

The differences in the expression of nuclear hormone receptor (HR) reflecting nuclear receptor pathway activity between the archival and de novo samples. Using HTG panel in BET \[targeted tumor RNA (TTR)\] population and Tempus RNAseq in BET \[whole transcriptome tumor RNA (WTTR)\] population. The unit of HTG expression data for nuclear hormone receptors is normalized expression counts. This Outcome Measure analysis was only conducted for Cohorts 5 \& 6 as per protocol.

Outcome measures

Outcome measures
Measure
HR+ HER2- Adenocarcinoma of the Breast With NGS Results
n=2 Participants
Participants in Cohort 4 with progressive disease on 1st line combination of doublet palbociclib with hormonal therapy and with NGS results from pre-treatment and post-progression tumor samples available.
Castrate-resistant Adenocarcinoma of the Prostate With NGS Results
n=6 Participants
Participants in Cohort 5 \& 6 with progressive disease on enzalutamide monotherapy and on abiraterone in combination with prednisone and with NGS results from pre-treatment and post-progression tumor samples available.
HR+ HER2- Adenocarcinoma of the Breast With Whole Exome Sequencing NGS Results
Participants in Cohort 4 with progressive disease on 1st line combination of doublet palbociclib with hormonal therapy and with whole exome sequencing NGS results from pre-treatment and post-progression tumor samples available.
Castrate-resistant Adenocarcinoma of the Prostate With Whole Exome Sequencing NGS Results
Participants in Cohort 5 \& 6 with progressive disease on enzalutamide monotherapy and on abiraterone in combination with prednisone and with whole exome sequencing NGS results from pre-treatment and post-progression tumor samples available.
Cohort 5: Castrate-resistant Adenocarcinoma of the Prostate
Progressive disease on enzalutamide monotherapy.
Cohort 6: Castrate-resistant Adenocarcinoma of the Prostate
Progressive disease on abiraterone in combination with prednisone.
Cohort 7: gBRCAm HER2- Adenocarcinoma of the Breast
Progressive disease on a PARP inhibitor monotherapy in participants previously treated with chemotherapy in the neoadjuvant, adjuvant, or metastatic setting.
Change in Expression of Nuclear Hormone Receptors Between Pre-Treatment Archival and Post-Progression Samples
ESR1
0.3 normalized expression counts
Interval -16.4 to 17.1
25.6 normalized expression counts
Interval -11.2 to 62.5
Change in Expression of Nuclear Hormone Receptors Between Pre-Treatment Archival and Post-Progression Samples
ESR2
-0.4 normalized expression counts
Interval -6.3 to 5.5
-1.1 normalized expression counts
Interval -2.3 to 0.1
Change in Expression of Nuclear Hormone Receptors Between Pre-Treatment Archival and Post-Progression Samples
NR3C1
0.5 normalized expression counts
Interval -1.2 to 2.1
5.4 normalized expression counts
Interval -30.7 to 41.5
Change in Expression of Nuclear Hormone Receptors Between Pre-Treatment Archival and Post-Progression Samples
NR3C2
3.7 normalized expression counts
Interval -18.2 to 25.6
Change in Expression of Nuclear Hormone Receptors Between Pre-Treatment Archival and Post-Progression Samples
PGR
-0.5 normalized expression counts
Interval -13.4 to 12.4
2.0 normalized expression counts
Interval -3.9 to 7.9
Change in Expression of Nuclear Hormone Receptors Between Pre-Treatment Archival and Post-Progression Samples
AR
-0.7 normalized expression counts
Interval -10.9 to 9.4
549.9 normalized expression counts
Interval -480.1 to 1579.9

Adverse Events

Cohort 1: NSCLC Monotherapy

Serious events: 0 serious events
Other events: 0 other events
Deaths: 0 deaths

Cohort 2: NSCLC Combination

Serious events: 0 serious events
Other events: 0 other events
Deaths: 0 deaths

Cohort 3: RCC With Clear Cell Component

Serious events: 0 serious events
Other events: 0 other events
Deaths: 0 deaths

Cohort 4: HR+ HER2- Adenocarcinoma of the Breast

Serious events: 0 serious events
Other events: 1 other events
Deaths: 0 deaths

Cohort 5: Castrate-resistant Adenocarcinoma of the Prostate

Serious events: 0 serious events
Other events: 1 other events
Deaths: 0 deaths

Cohort 6: Castrate-resistant Adenocarcinoma of the Prostate

Serious events: 0 serious events
Other events: 0 other events
Deaths: 0 deaths

Cohort 7: gBRCAm HER2- Adenocarcinoma of the Breast

Serious events: 0 serious events
Other events: 0 other events
Deaths: 0 deaths

Serious adverse events

Adverse event data not reported

Other adverse events

Other adverse events
Measure
Cohort 1: NSCLC Monotherapy
n=1 participants at risk
Progressive disease on 1st line monotherapy anti-PD-1/-L1.
Cohort 2: NSCLC Combination
n=4 participants at risk
Progressive disease on 1st line anti-PD-1/-L1 plus standard doublet platinum-containing regimen; or progressive disease on 1st line anti-PD-1/-L1 plus standard doublet platinum-containing regimen followed by continuation of single agent anti-PD-1/-L1.
Cohort 3: RCC With Clear Cell Component
n=5 participants at risk
Progressive disease on 2nd line monotherapy anti-PD-1/-L1; or progressive disease on 1st line combination of doublet anti-PD-1/-L1 with anti-CTLA-4; or progressive disease on 1st line combination of avelumab with axitinib or pembrolizumab with axitinib.
Cohort 4: HR+ HER2- Adenocarcinoma of the Breast
n=10 participants at risk
Progressive disease on 1st line combination of doublet palbociclib with hormonal therapy.
Cohort 5: Castrate-resistant Adenocarcinoma of the Prostate
n=5 participants at risk
Progressive disease on enzalutamide monotherapy.
Cohort 6: Castrate-resistant Adenocarcinoma of the Prostate
n=10 participants at risk
Progressive disease on abiraterone in combination with prednisone.
Cohort 7: gBRCAm HER2- Adenocarcinoma of the Breast
n=1 participants at risk
Progressive disease on a PARP inhibitor monotherapy in participants previously treated with chemotherapy in the neoadjuvant, adjuvant, or metastatic setting.
Injury, poisoning and procedural complications
Post procedural contusion
0.00%
0/1 • From Biospecimen Collection Day 1 to Post-Biospecimen Follow-up ≤30 days after receipt of NGS results at the provider's facility, approximately 3 months through study completion.
0.00%
0/4 • From Biospecimen Collection Day 1 to Post-Biospecimen Follow-up ≤30 days after receipt of NGS results at the provider's facility, approximately 3 months through study completion.
0.00%
0/5 • From Biospecimen Collection Day 1 to Post-Biospecimen Follow-up ≤30 days after receipt of NGS results at the provider's facility, approximately 3 months through study completion.
10.0%
1/10 • From Biospecimen Collection Day 1 to Post-Biospecimen Follow-up ≤30 days after receipt of NGS results at the provider's facility, approximately 3 months through study completion.
0.00%
0/5 • From Biospecimen Collection Day 1 to Post-Biospecimen Follow-up ≤30 days after receipt of NGS results at the provider's facility, approximately 3 months through study completion.
0.00%
0/10 • From Biospecimen Collection Day 1 to Post-Biospecimen Follow-up ≤30 days after receipt of NGS results at the provider's facility, approximately 3 months through study completion.
0.00%
0/1 • From Biospecimen Collection Day 1 to Post-Biospecimen Follow-up ≤30 days after receipt of NGS results at the provider's facility, approximately 3 months through study completion.
Nervous system disorders
Syncope
0.00%
0/1 • From Biospecimen Collection Day 1 to Post-Biospecimen Follow-up ≤30 days after receipt of NGS results at the provider's facility, approximately 3 months through study completion.
0.00%
0/4 • From Biospecimen Collection Day 1 to Post-Biospecimen Follow-up ≤30 days after receipt of NGS results at the provider's facility, approximately 3 months through study completion.
0.00%
0/5 • From Biospecimen Collection Day 1 to Post-Biospecimen Follow-up ≤30 days after receipt of NGS results at the provider's facility, approximately 3 months through study completion.
0.00%
0/10 • From Biospecimen Collection Day 1 to Post-Biospecimen Follow-up ≤30 days after receipt of NGS results at the provider's facility, approximately 3 months through study completion.
20.0%
1/5 • From Biospecimen Collection Day 1 to Post-Biospecimen Follow-up ≤30 days after receipt of NGS results at the provider's facility, approximately 3 months through study completion.
0.00%
0/10 • From Biospecimen Collection Day 1 to Post-Biospecimen Follow-up ≤30 days after receipt of NGS results at the provider's facility, approximately 3 months through study completion.
0.00%
0/1 • From Biospecimen Collection Day 1 to Post-Biospecimen Follow-up ≤30 days after receipt of NGS results at the provider's facility, approximately 3 months through study completion.
Skin and subcutaneous tissue disorders
Dermatitis contact
0.00%
0/1 • From Biospecimen Collection Day 1 to Post-Biospecimen Follow-up ≤30 days after receipt of NGS results at the provider's facility, approximately 3 months through study completion.
0.00%
0/4 • From Biospecimen Collection Day 1 to Post-Biospecimen Follow-up ≤30 days after receipt of NGS results at the provider's facility, approximately 3 months through study completion.
0.00%
0/5 • From Biospecimen Collection Day 1 to Post-Biospecimen Follow-up ≤30 days after receipt of NGS results at the provider's facility, approximately 3 months through study completion.
10.0%
1/10 • From Biospecimen Collection Day 1 to Post-Biospecimen Follow-up ≤30 days after receipt of NGS results at the provider's facility, approximately 3 months through study completion.
0.00%
0/5 • From Biospecimen Collection Day 1 to Post-Biospecimen Follow-up ≤30 days after receipt of NGS results at the provider's facility, approximately 3 months through study completion.
0.00%
0/10 • From Biospecimen Collection Day 1 to Post-Biospecimen Follow-up ≤30 days after receipt of NGS results at the provider's facility, approximately 3 months through study completion.
0.00%
0/1 • From Biospecimen Collection Day 1 to Post-Biospecimen Follow-up ≤30 days after receipt of NGS results at the provider's facility, approximately 3 months through study completion.
Injury, poisoning and procedural complications
Procedural pain
0.00%
0/1 • From Biospecimen Collection Day 1 to Post-Biospecimen Follow-up ≤30 days after receipt of NGS results at the provider's facility, approximately 3 months through study completion.
0.00%
0/4 • From Biospecimen Collection Day 1 to Post-Biospecimen Follow-up ≤30 days after receipt of NGS results at the provider's facility, approximately 3 months through study completion.
0.00%
0/5 • From Biospecimen Collection Day 1 to Post-Biospecimen Follow-up ≤30 days after receipt of NGS results at the provider's facility, approximately 3 months through study completion.
10.0%
1/10 • From Biospecimen Collection Day 1 to Post-Biospecimen Follow-up ≤30 days after receipt of NGS results at the provider's facility, approximately 3 months through study completion.
0.00%
0/5 • From Biospecimen Collection Day 1 to Post-Biospecimen Follow-up ≤30 days after receipt of NGS results at the provider's facility, approximately 3 months through study completion.
0.00%
0/10 • From Biospecimen Collection Day 1 to Post-Biospecimen Follow-up ≤30 days after receipt of NGS results at the provider's facility, approximately 3 months through study completion.
0.00%
0/1 • From Biospecimen Collection Day 1 to Post-Biospecimen Follow-up ≤30 days after receipt of NGS results at the provider's facility, approximately 3 months through study completion.

Additional Information

Pfizer ClinicalTrials.gov Call Center

Pfizer, Inc.

Phone: 1-800-718-1021

Results disclosure agreements

  • Principal investigator is a sponsor employee Pfizer has the right to review disclosures, requesting a delay of less than 60 days. Investigator will postpone single center publications until after disclosure of pooled data (all sites), less than 12 months from study completion/termination at all participating sites. Investigator may not disclose previously undisclosed confidential information other than study results.
  • Publication restrictions are in place

Restriction type: OTHER